Incidental Mutation 'R3803:Clstn1'
ID274407
Institutional Source Beutler Lab
Gene Symbol Clstn1
Ensembl Gene ENSMUSG00000039953
Gene Namecalsyntenin 1
SynonymsCst-1, calsyntenin-1, 1810034E21Rik, alcadein alpha
MMRRC Submission 040878-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3803 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location149586468-149648899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149635339 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 437 (H437R)
Ref Sequence ENSEMBL: ENSMUSP00000101316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039144] [ENSMUST00000105691]
Predicted Effect probably benign
Transcript: ENSMUST00000039144
AA Change: H447R

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000036962
Gene: ENSMUSG00000039953
AA Change: H447R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 59 162 1.25e-11 SMART
CA 185 263 1.03e-3 SMART
Pfam:Laminin_G_3 365 510 3.3e-9 PFAM
low complexity region 663 674 N/A INTRINSIC
transmembrane domain 860 882 N/A INTRINSIC
coiled coil region 915 949 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105691
AA Change: H437R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101316
Gene: ENSMUSG00000039953
AA Change: H437R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 59 152 2.91e-12 SMART
CA 175 253 1.03e-3 SMART
Pfam:Laminin_G_3 350 544 1.1e-12 PFAM
low complexity region 653 664 N/A INTRINSIC
transmembrane domain 850 872 N/A INTRINSIC
coiled coil region 905 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151895
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calsyntenin family, a subset of the cadherin superfamily. The encoded transmembrane protein, also known as alcadein-alpha, is thought to bind to kinesin-1 motors to mediate the axonal anterograde transport of certain types of vesicle. Amyloid precursor protein (APP) is trafficked via these vesicles and so this protein is being investigated to see how it might contribute to the mechanisms underlying Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Juvenile mice homozygous for a null allele show reduced basal excitatory synaptic transmission, abnormal excitatory postsynaptic currents, enhanced NMDA receptor-dependent long term potentiation, and delayed dendritic spine maturation in CA1 hippocampal pyramidal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,508,338 probably null Het
A2ml1 T C 6: 128,545,070 N1263S probably benign Het
Alpk1 A C 3: 127,679,837 V839G possibly damaging Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Aox2 T A 1: 58,289,899 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Arhgap24 T C 5: 102,892,442 V508A probably damaging Het
Arhgap9 T A 10: 127,329,517 D598E possibly damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Cspp1 C A 1: 10,126,373 D157E probably damaging Het
Cyp4f16 T C 17: 32,544,884 S217P possibly damaging Het
Ddx50 C A 10: 62,639,944 V333F probably damaging Het
Dnaic2 A G 11: 114,738,725 S193G probably benign Het
Dync2h1 A T 9: 6,935,293 H4236Q probably benign Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Erich6 T A 3: 58,621,332 Y499F probably damaging Het
Fa2h A G 8: 111,355,398 probably null Het
Gli1 T A 10: 127,338,065 probably benign Het
Gm14403 A G 2: 177,508,776 S172G probably benign Het
Grhl1 C T 12: 24,584,919 T330M probably damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Helz2 A G 2: 181,239,996 F335L probably damaging Het
Hr G A 14: 70,557,893 A322T probably benign Het
Iapp A G 6: 142,303,425 N68S probably benign Het
Kctd4 A T 14: 75,963,286 L232F probably benign Het
Kdm5b A G 1: 134,615,941 I783V probably benign Het
Larp4b T A 13: 9,158,554 N414K probably benign Het
Ldb2 T C 5: 44,473,394 E337G probably benign Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Luc7l3 A T 11: 94,293,166 probably benign Het
Ndrg2 C A 14: 51,910,675 probably null Het
Ndufaf3 C A 9: 108,566,893 R12L probably benign Het
Nol4 A T 18: 22,694,955 L634I probably damaging Het
Npr3 C T 15: 11,895,790 A257T probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1284 A T 2: 111,379,293 M98L possibly damaging Het
Olfr576 T C 7: 102,966,021 probably null Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pclo C T 5: 14,515,402 Q61* probably null Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Pkhd1l1 T C 15: 44,493,135 L332P probably benign Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rgl3 A G 9: 21,976,025 I500T probably damaging Het
Rgs7 T A 1: 175,189,219 I62F probably benign Het
Rttn A G 18: 88,977,707 N205D probably damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Scn7a G A 2: 66,680,246 Q1271* probably null Het
Skor1 A G 9: 63,145,586 V339A probably benign Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc5a6 T C 5: 31,042,951 E130G probably damaging Het
Sorcs2 T A 5: 36,397,806 K80N probably benign Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Steap4 G T 5: 7,976,979 R314L probably damaging Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Trav7d-4 A T 14: 52,770,118 K23* probably null Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn2r52 A G 7: 10,173,512 S96P probably damaging Het
Wdr25 T C 12: 108,898,553 V208A probably damaging Het
Wdr27 C T 17: 14,918,109 V360M probably benign Het
Zfp54 T C 17: 21,433,552 C103R possibly damaging Het
Zfp618 A G 4: 63,133,019 E679G probably damaging Het
Zfp846 A G 9: 20,594,439 I532V probably benign Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Clstn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clstn1 APN 4 149635243 missense probably damaging 0.99
IGL00585:Clstn1 APN 4 149638312 missense probably benign 0.05
IGL00911:Clstn1 APN 4 149643191 splice site probably benign
IGL01394:Clstn1 APN 4 149634782 missense possibly damaging 0.87
IGL02193:Clstn1 APN 4 149645352 missense probably benign 0.03
IGL02406:Clstn1 APN 4 149627359 missense probably damaging 1.00
IGL02501:Clstn1 APN 4 149631842 missense probably damaging 1.00
IGL02641:Clstn1 APN 4 149629511 missense probably null 1.00
R0012:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0020:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0021:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0026:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0031:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0038:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0062:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0064:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0193:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0279:Clstn1 UTSW 4 149643674 missense probably damaging 1.00
R0394:Clstn1 UTSW 4 149644178 missense probably benign 0.00
R0609:Clstn1 UTSW 4 149629300 splice site probably null
R0685:Clstn1 UTSW 4 149646855 missense probably benign 0.24
R0724:Clstn1 UTSW 4 149643624 missense possibly damaging 0.84
R1016:Clstn1 UTSW 4 149646829 missense probably benign 0.21
R1470:Clstn1 UTSW 4 149634722 missense possibly damaging 0.94
R1470:Clstn1 UTSW 4 149634722 missense possibly damaging 0.94
R1622:Clstn1 UTSW 4 149629407 missense probably damaging 0.97
R1680:Clstn1 UTSW 4 149643726 missense probably benign 0.02
R3836:Clstn1 UTSW 4 149638333 missense probably damaging 1.00
R3838:Clstn1 UTSW 4 149638333 missense probably damaging 1.00
R4923:Clstn1 UTSW 4 149645029 missense probably benign 0.07
R5024:Clstn1 UTSW 4 149635294 missense possibly damaging 0.91
R5919:Clstn1 UTSW 4 149635246 missense probably damaging 1.00
R6269:Clstn1 UTSW 4 149644067 missense probably benign 0.00
R6354:Clstn1 UTSW 4 149643216 missense probably benign 0.05
R6382:Clstn1 UTSW 4 149626120 unclassified probably null
R6573:Clstn1 UTSW 4 149643689 missense probably damaging 1.00
X0020:Clstn1 UTSW 4 149635251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCAGTCCTTACTCTCCC -3'
(R):5'- AACCATAACGGCACTTTCACTT -3'

Sequencing Primer
(F):5'- TCCCCTTGGGCCTGAAGTTG -3'
(R):5'- TCAGCCTGGTCTACAAAGTG -3'
Posted On2015-04-02