Incidental Mutation 'R3803:Npr3'
ID274450
Institutional Source Beutler Lab
Gene Symbol Npr3
Ensembl Gene ENSMUSG00000022206
Gene Namenatriuretic peptide receptor 3
Synonymslongjohn, NPR-C, B430320C24Rik, Nppc receptor, lgj
MMRRC Submission 040878-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.577) question?
Stock #R3803 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location11839896-11907287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11895790 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 257 (A257T)
Ref Sequence ENSEMBL: ENSMUSP00000154180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066529] [ENSMUST00000228489] [ENSMUST00000228603]
Predicted Effect probably damaging
Transcript: ENSMUST00000066529
AA Change: A257T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066737
Gene: ENSMUSG00000022206
AA Change: A257T

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:ANF_receptor 66 417 1e-59 PFAM
transmembrane domain 477 499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226139
Predicted Effect probably damaging
Transcript: ENSMUST00000228489
AA Change: A3T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000228603
AA Change: A257T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three natriuretic peptide receptors. Natriutetic peptides are small peptides which regulate blood volume and pressure, pulmonary hypertension, and cardiac function as well as some metabolic and growth processes. The product of this gene encodes a natriuretic peptide receptor responsible for clearing circulating and extracellular natriuretic peptides through endocytosis of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous inactivation of this gene leads to partial postnatal lethality, altered blood homeostasis, polyuria, hypovolemia, hypotension, increased bone turnover, skeletal deformities and altered adipose morphology. Spontaneous and ENU-induced mutations cause a skeletal-overgrowth phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,508,338 probably null Het
A2ml1 T C 6: 128,545,070 N1263S probably benign Het
Alpk1 A C 3: 127,679,837 V839G possibly damaging Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Aox2 T A 1: 58,289,899 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Arhgap24 T C 5: 102,892,442 V508A probably damaging Het
Arhgap9 T A 10: 127,329,517 D598E possibly damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Clstn1 A G 4: 149,635,339 H437R probably damaging Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Cspp1 C A 1: 10,126,373 D157E probably damaging Het
Cyp4f16 T C 17: 32,544,884 S217P possibly damaging Het
Ddx50 C A 10: 62,639,944 V333F probably damaging Het
Dnaic2 A G 11: 114,738,725 S193G probably benign Het
Dync2h1 A T 9: 6,935,293 H4236Q probably benign Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Erich6 T A 3: 58,621,332 Y499F probably damaging Het
Fa2h A G 8: 111,355,398 probably null Het
Gli1 T A 10: 127,338,065 probably benign Het
Gm14403 A G 2: 177,508,776 S172G probably benign Het
Grhl1 C T 12: 24,584,919 T330M probably damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Helz2 A G 2: 181,239,996 F335L probably damaging Het
Hr G A 14: 70,557,893 A322T probably benign Het
Iapp A G 6: 142,303,425 N68S probably benign Het
Kctd4 A T 14: 75,963,286 L232F probably benign Het
Kdm5b A G 1: 134,615,941 I783V probably benign Het
Larp4b T A 13: 9,158,554 N414K probably benign Het
Ldb2 T C 5: 44,473,394 E337G probably benign Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Luc7l3 A T 11: 94,293,166 probably benign Het
Ndrg2 C A 14: 51,910,675 probably null Het
Ndufaf3 C A 9: 108,566,893 R12L probably benign Het
Nol4 A T 18: 22,694,955 L634I probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1284 A T 2: 111,379,293 M98L possibly damaging Het
Olfr576 T C 7: 102,966,021 probably null Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pclo C T 5: 14,515,402 Q61* probably null Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Pkhd1l1 T C 15: 44,493,135 L332P probably benign Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rgl3 A G 9: 21,976,025 I500T probably damaging Het
Rgs7 T A 1: 175,189,219 I62F probably benign Het
Rttn A G 18: 88,977,707 N205D probably damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Scn7a G A 2: 66,680,246 Q1271* probably null Het
Skor1 A G 9: 63,145,586 V339A probably benign Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc5a6 T C 5: 31,042,951 E130G probably damaging Het
Sorcs2 T A 5: 36,397,806 K80N probably benign Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Steap4 G T 5: 7,976,979 R314L probably damaging Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Trav7d-4 A T 14: 52,770,118 K23* probably null Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn2r52 A G 7: 10,173,512 S96P probably damaging Het
Wdr25 T C 12: 108,898,553 V208A probably damaging Het
Wdr27 C T 17: 14,918,109 V360M probably benign Het
Zfp54 T C 17: 21,433,552 C103R possibly damaging Het
Zfp618 A G 4: 63,133,019 E679G probably damaging Het
Zfp846 A G 9: 20,594,439 I532V probably benign Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Npr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Npr3 APN 15 11895694 missense probably damaging 1.00
IGL01420:Npr3 APN 15 11858632 missense probably damaging 1.00
IGL01599:Npr3 APN 15 11895789 missense probably damaging 1.00
IGL01977:Npr3 APN 15 11858718 missense probably damaging 1.00
eel UTSW 15 11858647 missense probably damaging 0.99
R0581:Npr3 UTSW 15 11851450 missense probably damaging 0.99
R0607:Npr3 UTSW 15 11845282 missense probably benign 0.32
R1554:Npr3 UTSW 15 11848563 missense probably benign
R1779:Npr3 UTSW 15 11851486 missense probably damaging 1.00
R1793:Npr3 UTSW 15 11848579 missense probably benign 0.05
R1968:Npr3 UTSW 15 11904969 missense probably benign 0.31
R2379:Npr3 UTSW 15 11883363 missense probably damaging 0.99
R2883:Npr3 UTSW 15 11883324 missense possibly damaging 0.50
R3080:Npr3 UTSW 15 11905149 missense probably benign 0.01
R3745:Npr3 UTSW 15 11905491 missense probably damaging 1.00
R4166:Npr3 UTSW 15 11848513 missense probably benign 0.32
R4411:Npr3 UTSW 15 11905149 missense probably benign 0.01
R4412:Npr3 UTSW 15 11905149 missense probably benign 0.01
R4667:Npr3 UTSW 15 11905467 missense possibly damaging 0.58
R5209:Npr3 UTSW 15 11848603 missense possibly damaging 0.73
R5742:Npr3 UTSW 15 11883408 missense probably damaging 1.00
R6339:Npr3 UTSW 15 11845275 missense probably damaging 0.99
R6605:Npr3 UTSW 15 11905432 missense probably damaging 1.00
R6890:Npr3 UTSW 15 11883392 missense possibly damaging 0.89
S24628:Npr3 UTSW 15 11848563 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATCAAGTATGGCTCCGGAG -3'
(R):5'- GTCCCTCCTGTGGATAAGTG -3'

Sequencing Primer
(F):5'- ATCTATGGGCCTCACTAGAGCTG -3'
(R):5'- CCCTCCTGTGGATAAGTGGTGAC -3'
Posted On2015-04-02