Incidental Mutation 'R3805:Slc9b2'
ID274541
Institutional Source Beutler Lab
Gene Symbol Slc9b2
Ensembl Gene ENSMUSG00000037994
Gene Namesolute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2
SynonymsC80638, nha-oc, Nhedc2, NHE10, NHA2
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3805 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location135307700-135345387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135324588 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 222 (L222P)
Ref Sequence ENSEMBL: ENSMUSP00000060640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051849] [ENSMUST00000145195]
Predicted Effect probably damaging
Transcript: ENSMUST00000051849
AA Change: L222P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060640
Gene: ENSMUSG00000037994
AA Change: L222P

DomainStartEndE-ValueType
transmembrane domain 83 102 N/A INTRINSIC
Pfam:Na_H_Exchanger 116 515 4.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126034
Predicted Effect probably benign
Transcript: ENSMUST00000145195
SMART Domains Protein: ENSMUSP00000123083
Gene: ENSMUSG00000037994

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sodium hydrogen antiporters, such as NHEDC2, convert the proton motive force established by the respiratory chain or the F1F0 mitochondrial ATPase into sodium gradients that drive other energy-requiring processes, transduce environmental signals into cell responses, or function in drug efflux (Xiang et al., 2007 [PubMed 18000046]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal, with no detectable abnormalities in osteoclast differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Slc9b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Slc9b2 APN 3 135336395 missense probably benign 0.17
IGL03091:Slc9b2 APN 3 135329030 missense probably damaging 0.97
IGL03203:Slc9b2 APN 3 135326212 missense probably damaging 1.00
IGL03377:Slc9b2 APN 3 135336358 missense probably damaging 1.00
IGL02988:Slc9b2 UTSW 3 135318418 missense probably benign 0.02
R0008:Slc9b2 UTSW 3 135336508 missense possibly damaging 0.72
R0382:Slc9b2 UTSW 3 135318422 missense probably damaging 0.99
R0628:Slc9b2 UTSW 3 135323775 splice site probably benign
R1263:Slc9b2 UTSW 3 135336395 missense probably benign 0.17
R1478:Slc9b2 UTSW 3 135326102 missense probably benign 0.45
R1809:Slc9b2 UTSW 3 135317131 missense possibly damaging 0.90
R2060:Slc9b2 UTSW 3 135326266 missense probably damaging 0.99
R2119:Slc9b2 UTSW 3 135328982 splice site probably null
R3196:Slc9b2 UTSW 3 135336529 missense probably benign 0.04
R4127:Slc9b2 UTSW 3 135329837 missense probably benign 0.00
R4401:Slc9b2 UTSW 3 135336544 missense probably benign 0.04
R4402:Slc9b2 UTSW 3 135336544 missense probably benign 0.04
R4622:Slc9b2 UTSW 3 135332518 missense probably damaging 1.00
R6125:Slc9b2 UTSW 3 135330696 splice site probably null
R7081:Slc9b2 UTSW 3 135321937 missense probably benign 0.10
R7166:Slc9b2 UTSW 3 135326178 missense unknown
R7203:Slc9b2 UTSW 3 135330661 missense probably benign 0.04
R7307:Slc9b2 UTSW 3 135318390 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGGCACACTGTCTCTCAAAC -3'
(R):5'- CAAATGGTGCTGAAGTGACTATG -3'

Sequencing Primer
(F):5'- GCTAATTAGCTGAAGAACCCTTGAC -3'
(R):5'- ATGGAGTCAGGAAGTTCC -3'
Posted On2015-04-02