Incidental Mutation 'R3805:Aebp2'
List |< first << previous [record 60 of 1259] next >> last >|
ID274551
Institutional Source Beutler Lab
Gene Symbol Aebp2
Ensembl Gene ENSMUSG00000030232
Gene NameAE binding protein 2
SynonymsB230313N05Rik
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3805 (G1)
Quality Score217
Status Validated
Chromosome6
Chromosomal Location140622663-140678472 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCGGCC to GCGGCCGGCC at 140643949 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032359] [ENSMUST00000087614] [ENSMUST00000095350] [ENSMUST00000160836] [ENSMUST00000161335]
Predicted Effect probably null
Transcript: ENSMUST00000032359
SMART Domains Protein: ENSMUSP00000032359
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
ZnF_C2H2 32 57 1.26e-2 SMART
ZnF_C2H2 66 93 5.92e0 SMART
ZnF_C2H2 99 123 2.2e-2 SMART
low complexity region 149 165 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000068583
SMART Domains Protein: ENSMUSP00000064302
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
ZnF_C2H2 53 78 1.26e-2 SMART
ZnF_C2H2 87 114 5.92e0 SMART
ZnF_C2H2 120 144 2.2e-2 SMART
low complexity region 170 186 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000087614
SMART Domains Protein: ENSMUSP00000084896
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
low complexity region 1 71 N/A INTRINSIC
low complexity region 81 124 N/A INTRINSIC
low complexity region 128 199 N/A INTRINSIC
ZnF_C2H2 254 279 1.26e-2 SMART
ZnF_C2H2 288 315 5.92e0 SMART
ZnF_C2H2 321 345 2.2e-2 SMART
low complexity region 371 387 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095350
SMART Domains Protein: ENSMUSP00000092993
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
ZnF_C2H2 77 102 1.26e-2 SMART
ZnF_C2H2 111 138 5.92e0 SMART
ZnF_C2H2 144 168 2.2e-2 SMART
low complexity region 194 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160772
Predicted Effect probably null
Transcript: ENSMUST00000160836
SMART Domains Protein: ENSMUSP00000124148
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
ZnF_C2H2 32 57 1.26e-2 SMART
ZnF_C2H2 66 93 5.92e0 SMART
ZnF_C2H2 99 123 2.2e-2 SMART
low complexity region 149 165 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161335
SMART Domains Protein: ENSMUSP00000125479
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
ZnF_C2H2 32 57 1.26e-2 SMART
ZnF_C2H2 66 93 5.92e0 SMART
ZnF_C2H2 99 123 2.2e-2 SMART
low complexity region 149 165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162100
Predicted Effect probably null
Transcript: ENSMUST00000162903
SMART Domains Protein: ENSMUSP00000123897
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
ZnF_C2H2 2 26 2.2e-2 SMART
low complexity region 52 68 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation in this gene show complete embryonic lethality. Heterozygous mutant mice show aganglionic megacolon, hypopigmentation of the tail tip and hind toes, and a decreased startle reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Aebp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Aebp2 APN 6 140642254 missense probably benign 0.29
IGL01935:Aebp2 APN 6 140637657 unclassified probably benign
IGL02149:Aebp2 APN 6 140642284 missense probably benign 0.06
R0030:Aebp2 UTSW 6 140637747 missense probably damaging 0.99
R0091:Aebp2 UTSW 6 140644074 critical splice donor site probably null
R0744:Aebp2 UTSW 6 140642364 splice site probably null
R1603:Aebp2 UTSW 6 140642253 missense probably damaging 0.98
R1990:Aebp2 UTSW 6 140633738 missense probably damaging 1.00
R2073:Aebp2 UTSW 6 140633694 missense probably benign 0.41
R2075:Aebp2 UTSW 6 140633694 missense probably benign 0.41
R2971:Aebp2 UTSW 6 140633898 critical splice donor site probably null
R3911:Aebp2 UTSW 6 140647981 missense probably damaging 1.00
R3921:Aebp2 UTSW 6 140633735 missense probably damaging 1.00
R4020:Aebp2 UTSW 6 140642295 missense probably damaging 1.00
R4374:Aebp2 UTSW 6 140654258 utr 3 prime probably benign
R4856:Aebp2 UTSW 6 140644073 critical splice donor site probably null
R5022:Aebp2 UTSW 6 140637730 missense possibly damaging 0.90
R5140:Aebp2 UTSW 6 140633806 nonsense probably null
R5761:Aebp2 UTSW 6 140624217 unclassified probably benign
R6983:Aebp2 UTSW 6 140637663 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TAAAGCTGGTGGATTATGAGGC -3'
(R):5'- CAGTGTATAAATGTGAAGCCAGTG -3'

Sequencing Primer
(F):5'- CTGATAGTGGAGTTGCTGGACTC -3'
(R):5'- AAGCCAGTGTATACTTTGCCG -3'
Posted On2015-04-02