Incidental Mutation 'R3766:Pex5l'
ID274693
Institutional Source Beutler Lab
Gene Symbol Pex5l
Ensembl Gene ENSMUSG00000027674
Gene Nameperoxisomal biogenesis factor 5-like
SynonymsPex2, PXR2, TRIP8b, 1700016J08Rik
MMRRC Submission 040743-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R3766 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location32949408-33143247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33007178 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 174 (D174A)
Ref Sequence ENSEMBL: ENSMUSP00000142196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078226] [ENSMUST00000108224] [ENSMUST00000108225] [ENSMUST00000108226] [ENSMUST00000192093] [ENSMUST00000193289] [ENSMUST00000193681] [ENSMUST00000194016]
Predicted Effect probably benign
Transcript: ENSMUST00000078226
AA Change: D139A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000077353
Gene: ENSMUSG00000027674
AA Change: D139A

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108219
SMART Domains Protein: ENSMUSP00000103854
Gene: ENSMUSG00000027674

DomainStartEndE-ValueType
low complexity region 124 140 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
PDB:4EQF|A 266 362 8e-64 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108224
AA Change: D114A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103859
Gene: ENSMUSG00000027674
AA Change: D114A

DomainStartEndE-ValueType
low complexity region 88 104 N/A INTRINSIC
low complexity region 190 204 N/A INTRINSIC
TPR 325 358 6.95e-4 SMART
Blast:TPR 359 392 2e-14 BLAST
TPR 439 472 3.19e-3 SMART
TPR 473 506 3.47e-4 SMART
TPR 507 540 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108225
AA Change: D139A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000103860
Gene: ENSMUSG00000027674
AA Change: D139A

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108226
AA Change: D91A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103861
Gene: ENSMUSG00000027674
AA Change: D91A

DomainStartEndE-ValueType
low complexity region 65 81 N/A INTRINSIC
low complexity region 166 180 N/A INTRINSIC
TPR 301 334 6.95e-4 SMART
Blast:TPR 335 368 2e-14 BLAST
TPR 415 448 3.19e-3 SMART
TPR 449 482 3.47e-4 SMART
TPR 483 516 1.1e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122716
Predicted Effect probably benign
Transcript: ENSMUST00000192093
AA Change: D139A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000141387
Gene: ENSMUSG00000027674
AA Change: D139A

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193289
AA Change: D174A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000142008
Gene: ENSMUSG00000027674
AA Change: D174A

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193681
AA Change: D174A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000141454
Gene: ENSMUSG00000027674
AA Change: D174A

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194016
AA Change: D174A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000142196
Gene: ENSMUSG00000027674
AA Change: D174A

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation lacking isoform b exhibit exhibit reduced hyperpolarization-activated current in CA1 pyramidal neuron, impaired motor learning, impaired nest-building, decreased startle reflex, and decreased depression-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C T 5: 125,506,262 T294M probably damaging Het
Brf2 G T 8: 27,124,468 T230N possibly damaging Het
Ccne2 A G 4: 11,199,293 probably benign Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Cttnbp2nl G A 3: 105,004,801 T589I probably benign Het
Dock10 A G 1: 80,536,926 S1091P probably damaging Het
Fh1 A G 1: 175,614,750 V178A probably damaging Het
Fndc1 A G 17: 7,784,421 S111P probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Gm29394 C T 15: 58,048,628 probably benign Het
Herc2 A G 7: 56,163,824 D2601G probably damaging Het
Hspa13 T C 16: 75,765,086 D75G probably benign Het
Itgav T C 2: 83,801,885 probably null Het
Kif6 A T 17: 49,758,643 probably benign Het
Lypla1 G A 1: 4,840,978 R104Q probably benign Het
Map1b T C 13: 99,434,087 K709E unknown Het
Olfr504 G A 7: 108,565,195 P200L probably benign Het
Olfr685 A T 7: 105,180,881 I159K probably damaging Het
Pcdhb16 A T 18: 37,478,196 K70* probably null Het
Plac8l1 A T 18: 42,180,395 M94K probably benign Het
Plxna1 T C 6: 89,334,775 probably benign Het
Psg26 T C 7: 18,475,071 T471A probably benign Het
Pus3 C A 9: 35,566,672 T400K probably benign Het
Pxk T C 14: 8,136,863 probably benign Het
Rapgef2 T C 3: 79,088,750 T569A probably benign Het
Sall4 T C 2: 168,756,044 Q292R possibly damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc45a1 T C 4: 150,638,060 R456G probably damaging Het
Sox13 T C 1: 133,390,798 R81G possibly damaging Het
Spag9 A G 11: 94,060,283 probably benign Het
Ston1 C T 17: 88,635,360 P65S probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Tcim T A 8: 24,438,749 R50W probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Trim59 A G 3: 69,036,804 V401A probably benign Het
Trpm3 A C 19: 22,448,377 Q32P probably benign Het
Tubgcp5 T A 7: 55,830,866 M1018K probably damaging Het
Ube2o A G 11: 116,546,863 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uvrag G T 7: 98,888,143 S615* probably null Het
Vmn2r6 T A 3: 64,556,508 I302L probably benign Het
Vmn2r73 C T 7: 85,871,990 V257I probably benign Het
Other mutations in Pex5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Pex5l APN 3 32952597 missense probably damaging 1.00
IGL01621:Pex5l APN 3 33014961 splice site probably null
IGL01813:Pex5l APN 3 33082055 missense probably benign 0.02
IGL02313:Pex5l APN 3 32992992 missense probably benign 0.22
IGL02508:Pex5l APN 3 32992902 splice site probably benign
IGL02997:Pex5l APN 3 32955842 splice site probably benign
R0195:Pex5l UTSW 3 32992953 missense possibly damaging 0.87
R0674:Pex5l UTSW 3 32952616 missense probably damaging 1.00
R0729:Pex5l UTSW 3 32954536 splice site probably benign
R1500:Pex5l UTSW 3 33014980 missense probably damaging 1.00
R1513:Pex5l UTSW 3 33015013 nonsense probably null
R1695:Pex5l UTSW 3 32954382 missense probably benign 0.28
R1850:Pex5l UTSW 3 32950876 splice site probably null
R2165:Pex5l UTSW 3 32953132 synonymous probably null
R2679:Pex5l UTSW 3 33082052 missense probably benign 0.02
R2880:Pex5l UTSW 3 32993003 critical splice acceptor site probably null
R2881:Pex5l UTSW 3 32993003 critical splice acceptor site probably null
R3780:Pex5l UTSW 3 32950844 missense probably damaging 1.00
R3934:Pex5l UTSW 3 33007172 missense probably damaging 1.00
R3975:Pex5l UTSW 3 33015015 missense probably damaging 0.99
R4285:Pex5l UTSW 3 33007187 missense probably damaging 1.00
R4825:Pex5l UTSW 3 32992985 missense probably damaging 0.99
R4855:Pex5l UTSW 3 33142840 splice site probably benign
R4868:Pex5l UTSW 3 32952490 missense probably damaging 1.00
R5135:Pex5l UTSW 3 32955831 missense probably damaging 1.00
R5217:Pex5l UTSW 3 33007328 splice site probably null
R5223:Pex5l UTSW 3 32958796 missense probably damaging 1.00
R5362:Pex5l UTSW 3 32992916 missense probably damaging 1.00
R5398:Pex5l UTSW 3 32952490 missense probably damaging 1.00
R5829:Pex5l UTSW 3 33005990 missense probably benign 0.00
R6731:Pex5l UTSW 3 32958798 missense probably damaging 1.00
R7180:Pex5l UTSW 3 33024691 splice site probably null
R7452:Pex5l UTSW 3 33004318 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCTACTCATCTAAGCACAAAAGATG -3'
(R):5'- CAGGAAGTAAATGGCTTCTCTTGC -3'

Sequencing Primer
(F):5'- TTCCCAGCTTCCTGAAAGAG -3'
(R):5'- GCCTTCTTCTGTCTCCCATAGTG -3'
Posted On2015-04-02