Incidental Mutation 'R3766:Pxk'
ID274721
Institutional Source Beutler Lab
Gene Symbol Pxk
Ensembl Gene ENSMUSG00000033885
Gene NamePX domain containing serine/threonine kinase
SynonymsMONaKA, D14Ertd813e, C230080L11Rik
MMRRC Submission 040743-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R3766 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location8098211-8165117 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 8136863 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036682] [ENSMUST00000112689] [ENSMUST00000225653]
Predicted Effect probably benign
Transcript: ENSMUST00000036682
SMART Domains Protein: ENSMUSP00000035265
Gene: ENSMUSG00000033885

DomainStartEndE-ValueType
PX 17 122 1.62e-16 SMART
Pfam:Pkinase 183 441 1.1e-9 PFAM
Pfam:Pkinase_Tyr 185 309 2.5e-7 PFAM
low complexity region 483 536 N/A INTRINSIC
Pfam:WH2 549 577 1.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112689
SMART Domains Protein: ENSMUSP00000108309
Gene: ENSMUSG00000033885

DomainStartEndE-ValueType
PX 17 122 1.62e-16 SMART
Pfam:Pkinase_Tyr 185 309 3e-7 PFAM
Pfam:Pkinase 185 441 1.4e-10 PFAM
low complexity region 483 509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225616
Predicted Effect probably benign
Transcript: ENSMUST00000225653
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phox (PX) domain-containing protein which may be involved in synaptic transmission and the ligand-induced internalization and degradation of epidermal growth factors. Variations in this gene may be associated with susceptibility to systemic lupus erythematosus (SLE). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C T 5: 125,506,262 T294M probably damaging Het
Brf2 G T 8: 27,124,468 T230N possibly damaging Het
Ccne2 A G 4: 11,199,293 probably benign Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Cttnbp2nl G A 3: 105,004,801 T589I probably benign Het
Dock10 A G 1: 80,536,926 S1091P probably damaging Het
Fh1 A G 1: 175,614,750 V178A probably damaging Het
Fndc1 A G 17: 7,784,421 S111P probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Gm29394 C T 15: 58,048,628 probably benign Het
Herc2 A G 7: 56,163,824 D2601G probably damaging Het
Hspa13 T C 16: 75,765,086 D75G probably benign Het
Itgav T C 2: 83,801,885 probably null Het
Kif6 A T 17: 49,758,643 probably benign Het
Lypla1 G A 1: 4,840,978 R104Q probably benign Het
Map1b T C 13: 99,434,087 K709E unknown Het
Olfr504 G A 7: 108,565,195 P200L probably benign Het
Olfr685 A T 7: 105,180,881 I159K probably damaging Het
Pcdhb16 A T 18: 37,478,196 K70* probably null Het
Pex5l T G 3: 33,007,178 D174A probably benign Het
Plac8l1 A T 18: 42,180,395 M94K probably benign Het
Plxna1 T C 6: 89,334,775 probably benign Het
Psg26 T C 7: 18,475,071 T471A probably benign Het
Pus3 C A 9: 35,566,672 T400K probably benign Het
Rapgef2 T C 3: 79,088,750 T569A probably benign Het
Sall4 T C 2: 168,756,044 Q292R possibly damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc45a1 T C 4: 150,638,060 R456G probably damaging Het
Sox13 T C 1: 133,390,798 R81G possibly damaging Het
Spag9 A G 11: 94,060,283 probably benign Het
Ston1 C T 17: 88,635,360 P65S probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Tcim T A 8: 24,438,749 R50W probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Trim59 A G 3: 69,036,804 V401A probably benign Het
Trpm3 A C 19: 22,448,377 Q32P probably benign Het
Tubgcp5 T A 7: 55,830,866 M1018K probably damaging Het
Ube2o A G 11: 116,546,863 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uvrag G T 7: 98,888,143 S615* probably null Het
Vmn2r6 T A 3: 64,556,508 I302L probably benign Het
Vmn2r73 C T 7: 85,871,990 V257I probably benign Het
Other mutations in Pxk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Pxk APN 14 8130754 missense probably damaging 1.00
IGL01865:Pxk APN 14 8136923 missense possibly damaging 0.94
IGL03171:Pxk APN 14 8151014 splice site probably benign
PIT4131001:Pxk UTSW 14 8152130 missense probably benign 0.01
R0799:Pxk UTSW 14 8148123 missense probably benign 0.02
R1367:Pxk UTSW 14 8150915 splice site probably null
R1546:Pxk UTSW 14 8164091 missense probably damaging 1.00
R1800:Pxk UTSW 14 8151507 nonsense probably null
R1827:Pxk UTSW 14 8151507 nonsense probably null
R1828:Pxk UTSW 14 8151507 nonsense probably null
R1888:Pxk UTSW 14 8151540 missense probably damaging 1.00
R1888:Pxk UTSW 14 8151540 missense probably damaging 1.00
R1892:Pxk UTSW 14 8151507 nonsense probably null
R1893:Pxk UTSW 14 8151507 nonsense probably null
R4807:Pxk UTSW 14 8144133 missense probably damaging 1.00
R4816:Pxk UTSW 14 8136893 missense probably damaging 1.00
R4833:Pxk UTSW 14 8130653 missense probably damaging 1.00
R4974:Pxk UTSW 14 8140734 missense probably damaging 1.00
R5400:Pxk UTSW 14 8136911 missense probably benign 0.45
R6075:Pxk UTSW 14 8150964 missense probably benign 0.05
R6144:Pxk UTSW 14 8138011 missense probably damaging 0.99
R6211:Pxk UTSW 14 8163952 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTTGGTCCTTGGTAGTCCTCTA -3'
(R):5'- GTCAAGGACAATGCTTGAAGCAG -3'

Sequencing Primer
(F):5'- AAGGGGCCTTTTTATCGAAAGCC -3'
(R):5'- CTTGAAGCAGTGGGGAGGTAC -3'
Posted On2015-04-02