Incidental Mutation 'R3818:Tnfrsf11a'
ID274764
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11a
Ensembl Gene ENSMUSG00000026321
Gene Nametumor necrosis factor receptor superfamily, member 11a, NFKB activator
SynonymsTRANCE-R, Rank
MMRRC Submission 040772-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R3818 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location105780718-105847981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105809360 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 64 (T64I)
Ref Sequence ENSEMBL: ENSMUSP00000027559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027559]
PDB Structure
Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANK [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027559
AA Change: T64I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027559
Gene: ENSMUSG00000026321
AA Change: T64I

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
TNFR 35 69 1.48e-7 SMART
TNFR 72 113 2.59e-3 SMART
TNFR 115 152 4.28e-4 SMART
TNFR 155 195 5.27e-4 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 300 313 N/A INTRINSIC
low complexity region 495 511 N/A INTRINSIC
low complexity region 543 558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187812
Meta Mutation Damage Score 0.0336 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out or spontaneous allele exhibit a failure of tooth eruption, osteopetrosis, and abnormal immune system morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T C 10: 80,319,517 D54G probably damaging Het
Adra2b G T 2: 127,363,835 E86* probably null Het
Cachd1 A T 4: 100,990,865 D1059V probably damaging Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Col25a1 A G 3: 130,550,071 K396R possibly damaging Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Cyp4a30b G T 4: 115,459,009 A311S probably damaging Het
Dse T C 10: 34,153,433 I554V probably benign Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gpr21 C A 2: 37,518,312 T290N probably damaging Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Mamdc4 C T 2: 25,565,773 S840N probably benign Het
Olfr1104 G A 2: 87,021,710 T278I probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Pah A G 10: 87,522,004 probably benign Het
Pikfyve T A 1: 65,245,758 S794T probably damaging Het
Plekhn1 T C 4: 156,225,533 H108R probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Prkd1 A T 12: 50,419,884 probably benign Het
Pwp1 C T 10: 85,888,129 P498L possibly damaging Het
Rasa4 A G 5: 136,102,293 T414A possibly damaging Het
Rbm26 A T 14: 105,141,270 L594I probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Sorcs3 A G 19: 48,603,904 N336S probably benign Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Tlr4 A G 4: 66,841,316 E782G probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttl T C 2: 129,092,994 V358A probably damaging Het
Wdhd1 A G 14: 47,243,801 probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp939 T C 7: 39,473,368 noncoding transcript Het
Other mutations in Tnfrsf11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Tnfrsf11a APN 1 105809422 missense possibly damaging 0.80
IGL02429:Tnfrsf11a APN 1 105827718 missense probably benign 0.14
IGL03222:Tnfrsf11a APN 1 105821490 missense probably damaging 1.00
IGL03276:Tnfrsf11a APN 1 105821490 missense probably damaging 1.00
R0321:Tnfrsf11a UTSW 1 105844857 nonsense probably null
R0514:Tnfrsf11a UTSW 1 105826992 missense probably damaging 1.00
R0655:Tnfrsf11a UTSW 1 105808155 missense unknown
R1470:Tnfrsf11a UTSW 1 105825048 missense probably damaging 0.96
R1470:Tnfrsf11a UTSW 1 105825048 missense probably damaging 0.96
R1868:Tnfrsf11a UTSW 1 105844705 missense probably damaging 1.00
R2900:Tnfrsf11a UTSW 1 105827061 missense probably benign 0.03
R3418:Tnfrsf11a UTSW 1 105809405 missense possibly damaging 0.84
R3816:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3817:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3819:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3879:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R4037:Tnfrsf11a UTSW 1 105827739 splice site probably null
R4039:Tnfrsf11a UTSW 1 105827739 splice site probably null
R4238:Tnfrsf11a UTSW 1 105827237 missense probably damaging 1.00
R5708:Tnfrsf11a UTSW 1 105813820 intron probably null
R6102:Tnfrsf11a UTSW 1 105819946 missense possibly damaging 0.62
R6910:Tnfrsf11a UTSW 1 105844546 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGATGAATGGTCCTGTG -3'
(R):5'- TTTAACCTGAGGCACTGGGG -3'

Sequencing Primer
(F):5'- GTCCTGTGAGTCAAATCTATAGGC -3'
(R):5'- GGGCATATTTAACAAGATCCTGTGG -3'
Posted On2015-04-02