Incidental Mutation 'R3818:Mamdc4'
ID274765
Institutional Source Beutler Lab
Gene Symbol Mamdc4
Ensembl Gene ENSMUSG00000026941
Gene NameMAM domain containing 4
SynonymsLOC381352
MMRRC Submission 040772-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R3818 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25563115-25574845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25565773 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 840 (S840N)
Ref Sequence ENSEMBL: ENSMUSP00000109861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015236] [ENSMUST00000095117] [ENSMUST00000114223]
Predicted Effect probably benign
Transcript: ENSMUST00000015236
SMART Domains Protein: ENSMUSP00000015236
Gene: ENSMUSG00000015092

DomainStartEndE-ValueType
Pfam:MBF1 4 73 4.6e-29 PFAM
HTH_XRE 80 135 1.02e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095117
AA Change: S844N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092735
Gene: ENSMUSG00000026941
AA Change: S844N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 58 7.33e-1 SMART
MAM 66 227 3.56e-52 SMART
LDLa 233 272 3.5e-9 SMART
MAM 254 430 3.87e-53 SMART
LDLa 461 497 2.63e-4 SMART
MAM 493 653 5.33e-5 SMART
MAM 660 819 3.68e-68 SMART
MAM 820 979 1.07e-28 SMART
MAM 980 1148 2.07e-62 SMART
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114223
AA Change: S840N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109861
Gene: ENSMUSG00000026941
AA Change: S840N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 28 54 7.33e-1 SMART
MAM 62 223 3.56e-52 SMART
LDLa 229 268 3.5e-9 SMART
MAM 250 426 3.87e-53 SMART
LDLa 457 493 2.63e-4 SMART
MAM 489 649 5.33e-5 SMART
MAM 656 815 3.68e-68 SMART
MAM 816 975 1.07e-28 SMART
MAM 976 1144 2.07e-62 SMART
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152124
Predicted Effect unknown
Transcript: ENSMUST00000152237
AA Change: S741N
SMART Domains Protein: ENSMUSP00000119789
Gene: ENSMUSG00000026941
AA Change: S741N

DomainStartEndE-ValueType
LDLa 9 35 7.33e-1 SMART
MAM 43 204 3.56e-52 SMART
LDLa 210 249 3.5e-9 SMART
MAM 231 407 3.87e-53 SMART
LDLa 438 474 2.63e-4 SMART
MAM 558 717 2.27e-68 SMART
MAM 718 877 1.07e-28 SMART
MAM 878 1046 2.07e-62 SMART
transmembrane domain 1063 1085 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153008
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T C 10: 80,319,517 D54G probably damaging Het
Adra2b G T 2: 127,363,835 E86* probably null Het
Cachd1 A T 4: 100,990,865 D1059V probably damaging Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Col25a1 A G 3: 130,550,071 K396R possibly damaging Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Cyp4a30b G T 4: 115,459,009 A311S probably damaging Het
Dse T C 10: 34,153,433 I554V probably benign Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gpr21 C A 2: 37,518,312 T290N probably damaging Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Olfr1104 G A 2: 87,021,710 T278I probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Pah A G 10: 87,522,004 probably benign Het
Pikfyve T A 1: 65,245,758 S794T probably damaging Het
Plekhn1 T C 4: 156,225,533 H108R probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Prkd1 A T 12: 50,419,884 probably benign Het
Pwp1 C T 10: 85,888,129 P498L possibly damaging Het
Rasa4 A G 5: 136,102,293 T414A possibly damaging Het
Rbm26 A T 14: 105,141,270 L594I probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Sorcs3 A G 19: 48,603,904 N336S probably benign Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Tlr4 A G 4: 66,841,316 E782G probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttl T C 2: 129,092,994 V358A probably damaging Het
Wdhd1 A G 14: 47,243,801 probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp939 T C 7: 39,473,368 noncoding transcript Het
Other mutations in Mamdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mamdc4 APN 2 25563576 missense possibly damaging 0.53
IGL01994:Mamdc4 APN 2 25568534 missense possibly damaging 0.64
IGL02072:Mamdc4 APN 2 25568339 missense probably damaging 1.00
IGL02193:Mamdc4 APN 2 25564446 missense probably benign 0.02
IGL02673:Mamdc4 APN 2 25570054 missense probably benign
IGL03048:Mamdc4 UTSW 2 25569072 missense possibly damaging 0.67
R0135:Mamdc4 UTSW 2 25566920 missense possibly damaging 0.71
R0481:Mamdc4 UTSW 2 25571216 start codon destroyed probably null 0.08
R0490:Mamdc4 UTSW 2 25563581 missense probably benign 0.01
R0609:Mamdc4 UTSW 2 25564193 missense probably benign 0.30
R0729:Mamdc4 UTSW 2 25570036 missense probably damaging 0.98
R1365:Mamdc4 UTSW 2 25566024 missense probably damaging 1.00
R1533:Mamdc4 UTSW 2 25569747 missense possibly damaging 0.71
R1671:Mamdc4 UTSW 2 25568223 nonsense probably null
R1789:Mamdc4 UTSW 2 25567622 missense possibly damaging 0.59
R2002:Mamdc4 UTSW 2 25567232 missense probably damaging 1.00
R2013:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2014:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2056:Mamdc4 UTSW 2 25564168 missense probably benign 0.18
R2109:Mamdc4 UTSW 2 25569390 missense probably damaging 1.00
R2128:Mamdc4 UTSW 2 25569258 missense probably damaging 1.00
R2185:Mamdc4 UTSW 2 25569692 critical splice donor site probably null
R2473:Mamdc4 UTSW 2 25566332 missense probably damaging 0.99
R2496:Mamdc4 UTSW 2 25565902 missense probably damaging 1.00
R4591:Mamdc4 UTSW 2 25564597 missense possibly damaging 0.87
R4829:Mamdc4 UTSW 2 25565356 missense possibly damaging 0.85
R4898:Mamdc4 UTSW 2 25570023 missense probably damaging 0.98
R5209:Mamdc4 UTSW 2 25566923 missense probably damaging 0.97
R5268:Mamdc4 UTSW 2 25564690 missense possibly damaging 0.95
R5490:Mamdc4 UTSW 2 25565878 missense probably damaging 1.00
R6152:Mamdc4 UTSW 2 25567439 missense probably damaging 1.00
R6234:Mamdc4 UTSW 2 25570080 missense probably damaging 1.00
R6681:Mamdc4 UTSW 2 25567744 missense probably damaging 1.00
R6774:Mamdc4 UTSW 2 25566936 missense probably benign 0.06
X0022:Mamdc4 UTSW 2 25570192 missense probably damaging 1.00
X0025:Mamdc4 UTSW 2 25564686 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACCACCATGTAGTGCCCTTG -3'
(R):5'- GCAAGCTTAGCACTTGGTAAC -3'

Sequencing Primer
(F):5'- CTTGGGGAAGAGAGACCAGCATC -3'
(R):5'- TAACAGTGTAGGGTCGCCC -3'
Posted On2015-04-02