Incidental Mutation 'R3818:Gpr21'
ID274766
Institutional Source Beutler Lab
Gene Symbol Gpr21
Ensembl Gene ENSMUSG00000053164
Gene NameG protein-coupled receptor 21
Synonyms
MMRRC Submission 040772-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R3818 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location37516332-37520603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37518312 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 290 (T290N)
Ref Sequence ENSEMBL: ENSMUSP00000066449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061179] [ENSMUST00000065441] [ENSMUST00000066055] [ENSMUST00000112920] [ENSMUST00000183690]
Predicted Effect probably benign
Transcript: ENSMUST00000061179
SMART Domains Protein: ENSMUSP00000061624
Gene: ENSMUSG00000035437

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 433 1.1e-38 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Blast:TBC 803 880 9e-33 BLAST
coiled coil region 986 1038 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000065441
AA Change: T290N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066449
Gene: ENSMUSG00000053164
AA Change: T290N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 34 239 4.8e-7 PFAM
Pfam:7tm_4 34 307 3.3e-9 PFAM
Pfam:7tm_1 45 304 9.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066055
SMART Domains Protein: ENSMUSP00000068835
Gene: ENSMUSG00000035437

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 433 7.1e-39 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112920
SMART Domains Protein: ENSMUSP00000108542
Gene: ENSMUSG00000035437

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 432 1.6e-35 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Blast:TBC 803 880 9e-33 BLAST
coiled coil region 986 1038 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159737
Predicted Effect probably benign
Transcript: ENSMUST00000183690
SMART Domains Protein: ENSMUSP00000139145
Gene: ENSMUSG00000026915

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein-coupled receptor 1 family. G-protein coupled receptors are membrane proteins which activate signaling cascades as a response to extracellular stress. The encoded protein activates a Gq signal transduction pathway which mobilizes calcium. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit improved glucose tolerance, insulin response and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T C 10: 80,319,517 D54G probably damaging Het
Adra2b G T 2: 127,363,835 E86* probably null Het
Cachd1 A T 4: 100,990,865 D1059V probably damaging Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Col25a1 A G 3: 130,550,071 K396R possibly damaging Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Cyp4a30b G T 4: 115,459,009 A311S probably damaging Het
Dse T C 10: 34,153,433 I554V probably benign Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Mamdc4 C T 2: 25,565,773 S840N probably benign Het
Olfr1104 G A 2: 87,021,710 T278I probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Pah A G 10: 87,522,004 probably benign Het
Pikfyve T A 1: 65,245,758 S794T probably damaging Het
Plekhn1 T C 4: 156,225,533 H108R probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Prkd1 A T 12: 50,419,884 probably benign Het
Pwp1 C T 10: 85,888,129 P498L possibly damaging Het
Rasa4 A G 5: 136,102,293 T414A possibly damaging Het
Rbm26 A T 14: 105,141,270 L594I probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Sorcs3 A G 19: 48,603,904 N336S probably benign Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Tlr4 A G 4: 66,841,316 E782G probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttl T C 2: 129,092,994 V358A probably damaging Het
Wdhd1 A G 14: 47,243,801 probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp939 T C 7: 39,473,368 noncoding transcript Het
Other mutations in Gpr21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Gpr21 APN 2 37518421 nonsense probably null
IGL01877:Gpr21 APN 2 37518081 missense probably benign 0.13
IGL03265:Gpr21 APN 2 37518074 missense probably damaging 1.00
lasco UTSW 2 37517544 missense probably damaging 0.99
R0573:Gpr21 UTSW 2 37517544 missense probably damaging 0.99
R1548:Gpr21 UTSW 2 37518072 missense probably damaging 1.00
R1781:Gpr21 UTSW 2 37517538 missense probably benign 0.00
R1922:Gpr21 UTSW 2 37518338 missense probably damaging 0.99
R2011:Gpr21 UTSW 2 37517535 missense probably damaging 1.00
R2144:Gpr21 UTSW 2 37518231 missense probably benign 0.02
R3978:Gpr21 UTSW 2 37517850 missense probably benign 0.23
R4412:Gpr21 UTSW 2 37517432 intron probably benign
R4466:Gpr21 UTSW 2 37517558 missense probably benign 0.10
R6807:Gpr21 UTSW 2 37517962 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCGATTCAGCAGCCAGAATG -3'
(R):5'- TCTCCTTGAAAATAGAGCGACTG -3'

Sequencing Primer
(F):5'- TTCAGCAGCCAGAATGGGGAG -3'
(R):5'- CCCTCAGATATGAGATCCATTAGGG -3'
Posted On2015-04-02