Incidental Mutation 'R3818:Adra2b'
ID274768
Institutional Source Beutler Lab
Gene Symbol Adra2b
Ensembl Gene ENSMUSG00000058620
Gene Nameadrenergic receptor, alpha 2b
Synonymsalpha2B, [a]2B, Adra-2b
MMRRC Submission 040772-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.756) question?
Stock #R3818 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127363208-127367221 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 127363835 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 86 (E86*)
Ref Sequence ENSEMBL: ENSMUSP00000100539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071902] [ENSMUST00000104934]
Predicted Effect probably null
Transcript: ENSMUST00000071902
AA Change: E91*
SMART Domains Protein: ENSMUSP00000071798
Gene: ENSMUSG00000058620
AA Change: E91*

DomainStartEndE-ValueType
Pfam:7tm_4 23 168 1.7e-9 PFAM
Pfam:7TM_GPCR_Srx 25 159 9.5e-10 PFAM
Pfam:7TM_GPCR_Srsx 28 218 1.2e-10 PFAM
Pfam:7tm_1 34 429 6.8e-73 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000104934
AA Change: E86*
SMART Domains Protein: ENSMUSP00000100539
Gene: ENSMUSG00000058620
AA Change: E86*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 20 154 4e-9 PFAM
Pfam:7TM_GPCR_Srsx 23 213 1.9e-10 PFAM
Pfam:7tm_1 29 424 7e-77 PFAM
Meta Mutation Damage Score 0.626 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a seven-pass transmembrane protein. This protein is a member of a subfamily of G protein-coupled receptors that regulate neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice exhibit poor survival and breeding, lack the vasoconstrictor response to alpha2-adrenergic receptor agonists, and display background strain dependent postnatal respiratory failure. Heterozygotes show an attenuated hypertensive response to subtotal nephrectomy and salt loading. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T C 10: 80,319,517 D54G probably damaging Het
Cachd1 A T 4: 100,990,865 D1059V probably damaging Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Col25a1 A G 3: 130,550,071 K396R possibly damaging Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Cyp4a30b G T 4: 115,459,009 A311S probably damaging Het
Dse T C 10: 34,153,433 I554V probably benign Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gpr21 C A 2: 37,518,312 T290N probably damaging Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Mamdc4 C T 2: 25,565,773 S840N probably benign Het
Olfr1104 G A 2: 87,021,710 T278I probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Pah A G 10: 87,522,004 probably benign Het
Pikfyve T A 1: 65,245,758 S794T probably damaging Het
Plekhn1 T C 4: 156,225,533 H108R probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Prkd1 A T 12: 50,419,884 probably benign Het
Pwp1 C T 10: 85,888,129 P498L possibly damaging Het
Rasa4 A G 5: 136,102,293 T414A possibly damaging Het
Rbm26 A T 14: 105,141,270 L594I probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Sorcs3 A G 19: 48,603,904 N336S probably benign Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Tlr4 A G 4: 66,841,316 E782G probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttl T C 2: 129,092,994 V358A probably damaging Het
Wdhd1 A G 14: 47,243,801 probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp939 T C 7: 39,473,368 noncoding transcript Het
Other mutations in Adra2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03181:Adra2b APN 2 127363983 missense probably benign 0.09
R0081:Adra2b UTSW 2 127364292 missense probably benign
R1964:Adra2b UTSW 2 127363814 missense probably damaging 1.00
R2265:Adra2b UTSW 2 127363871 missense probably damaging 1.00
R3156:Adra2b UTSW 2 127363650 missense probably damaging 1.00
R4818:Adra2b UTSW 2 127364092 nonsense probably null
R5893:Adra2b UTSW 2 127364482 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAATGCGCTGGTAATTCTG -3'
(R):5'- TCTTGGTTGAGCTCACACTG -3'

Sequencing Primer
(F):5'- AATTCTGGCTGTGTTGACCAGC -3'
(R):5'- TTGAGCTCACACTGGGGGAG -3'
Posted On2015-04-02