Mutagenetix > Incidental Mutations

Incidental Mutation 'R3818:Ttl'

274769

Institutional Source

Beutler Lab

Gene Symbol

Ttl

Ensembl Gene

ENSMUSG00000027394

Gene Name

tubulin tyrosine ligase

Synonyms

MMRRC Submission

040772-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3818 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129065942-129096283 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 129092994 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 358 (V358A)

Ref Sequence

ENSEMBL: ENSMUSP00000046883 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035812]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035812
AA Change: V358A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000046883
Gene: ENSMUSG00000027394
AA Change: V358A

Domain	Start	End	E-Value	Type
Pfam:TTL	54	367	1.2e-72	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144120

SMART Domains

Protein: ENSMUSP00000117506
Gene: ENSMUSG00000027394

Domain	Start	End	E-Value	Type
Pfam:TTL	1	199	2.3e-64	PFAM

Meta Mutation Damage Score

0.244

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.4%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TTL is a cytosolic enzyme involved in the posttranslational modification of alpha-tubulin (see MIM 602529). Alpha-tubulin within assembled microtubules is detyrosinated over time at the C terminus. After microtubule disassembly, TTL restores the tyrosine residues and consequently participates in a cycle of tubulin detyrosination and tyrosination (Erck et al., 2003 [PubMed 14571137]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, impaired breathing, and fail to form the internal capsule in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310011J03Rik	T	C	10: 80,319,517	D54G	probably damaging	Het
Adra2b	G	T	2: 127,363,835	E86*	probably null	Het
Cachd1	A	T	4: 100,990,865	D1059V	probably damaging	Het
Cd177	A	G	7: 24,754,392	V358A	probably benign	Het
Col25a1	A	G	3: 130,550,071	K396R	possibly damaging	Het
Csmd1	C	T	8: 16,002,522	A2201T	probably damaging	Het
Cyp4a12b	A	T	4: 115,432,470	D178V	probably damaging	Het
Cyp4a30b	G	T	4: 115,459,009	A311S	probably damaging	Het
Dse	T	C	10: 34,153,433	I554V	probably benign	Het
Gabrg3	G	A	7: 57,381,664	Q43*	probably null	Het
Gjb2	A	G	14: 57,100,073	V226A	probably benign	Het
Gpr21	C	A	2: 37,518,312	T290N	probably damaging	Het
Gsdme	A	C	6: 50,219,411	S340A	probably benign	Het
Hivep2	T	C	10: 14,143,941	V2152A	possibly damaging	Het
Mamdc4	C	T	2: 25,565,773	S840N	probably benign	Het
Olfr1104	G	A	2: 87,021,710	T278I	probably benign	Het
Olfr483	A	G	7: 108,103,498	Y63C	possibly damaging	Het
Pah	A	G	10: 87,522,004		probably benign	Het
Pikfyve	T	A	1: 65,245,758	S794T	probably damaging	Het
Plekhn1	T	C	4: 156,225,533	H108R	probably damaging	Het
Pomgnt1	T	A	4: 116,153,942		probably null	Het
Prkd1	A	T	12: 50,419,884		probably benign	Het
Pwp1	C	T	10: 85,888,129	P498L	possibly damaging	Het
Rasa4	A	G	5: 136,102,293	T414A	possibly damaging	Het
Rbm26	A	T	14: 105,141,270	L594I	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Skint5	A	G	4: 113,629,122		probably benign	Het
Sorcs3	A	G	19: 48,603,904	N336S	probably benign	Het
Sspo	A	T	6: 48,481,103	E3269V	possibly damaging	Het
Tlr4	A	G	4: 66,841,316	E782G	probably benign	Het
Tnfrsf11a	C	T	1: 105,809,360	T64I	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Wdhd1	A	G	14: 47,243,801		probably null	Het
Wdr37	A	G	13: 8,853,596		probably benign	Het
Zfp939	T	C	7: 39,473,368		noncoding transcript	Het

Other mutations in Ttl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02742:Ttl	APN	2	129066293	missense	possibly damaging	0.50
IGL02970:Ttl	APN	2	129076070	missense	probably damaging	1.00
R0363:Ttl	UTSW	2	129076061	missense	probably damaging	0.99
R2290:Ttl	UTSW	2	129081270	missense	possibly damaging	0.69
R4345:Ttl	UTSW	2	129075858	missense	probably damaging	1.00
R4471:Ttl	UTSW	2	129082057	missense	probably benign
R4866:Ttl	UTSW	2	129081227	missense	probably damaging	1.00
R5269:Ttl	UTSW	2	129068911	missense	probably damaging	1.00
R5913:Ttl	UTSW	2	129076041	missense	probably benign
R5941:Ttl	UTSW	2	129075984	missense	probably benign	0.00
R6287:Ttl	UTSW	2	129089121	missense	probably damaging	1.00
R6643:Ttl	UTSW	2	129081342	missense	possibly damaging	0.72
R6821:Ttl	UTSW	2	129068915	missense	probably damaging	1.00
R6885:Ttl	UTSW	2	129082072	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- TCTGTGTGCAGAGCCTCTTG -3'
(R):5'- TTCAGAGAAGTGCTGGGCTC -3'

Sequencing Primer
(F):5'- TGGGTACTTTATTCACAGAGACGAG -3'
(R):5'- GCTTCCCAAGGTCTCCACAG -3'

Posted On

2015-04-02