Incidental Mutation 'R3818:Tlr4'
ID274771
Institutional Source Beutler Lab
Gene Symbol Tlr4
Ensembl Gene ENSMUSG00000039005
Gene Nametoll-like receptor 4
SynonymsRasl2-8, Lps, lipopolysaccharide response
MMRRC Submission 040772-MU
Accession Numbers

MGI: 96824

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3818 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location66827584-66930284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66841316 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 782 (E782G)
Ref Sequence ENSEMBL: ENSMUSP00000045770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048096]
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000048096
AA Change: E782G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: E782G

DomainStartEndE-ValueType
LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147008
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (34/34)
MGI Phenotype Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria.
Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T C 10: 80,319,517 D54G probably damaging Het
Adra2b G T 2: 127,363,835 E91* probably null Het
Cachd1 A T 4: 100,990,865 D1059V probably damaging Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Col25a1 A G 3: 130,550,071 K396R possibly damaging Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Cyp4a30b G T 4: 115,459,009 A311S probably damaging Het
Dfna5 A C 6: 50,219,411 S340A probably benign Het
Dse T C 10: 34,153,433 I554V probably benign Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gpr21 C A 2: 37,518,312 T290N probably damaging Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Mamdc4 C T 2: 25,565,773 S844N probably benign Het
Olfr1104 G A 2: 87,021,710 T278I probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Pah A G 10: 87,522,004 unknown Het
Pikfyve T A 1: 65,245,758 S794T probably damaging Het
Plekhn1 T C 4: 156,225,533 H108R probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Prkd1 A T 12: 50,419,884 unknown Het
Pwp1 C T 10: 85,888,129 P498L possibly damaging Het
Rasa4 A G 5: 136,102,293 T414A possibly damaging Het
Rbm26 A T 14: 105,141,270 L594I probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Sorcs3 A G 19: 48,603,904 N336S probably benign Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttl T C 2: 129,092,994 V358A probably damaging Het
Wdhd1 A G 14: 47,243,801 probably null Het
Wdr37 A G 13: 8,853,596 I157T unknown Het
Zfp939 T C 7: 39,473,368 noncoding transcript Het
Other mutations in Tlr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 unclassified noncoding transcript
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 unclassified probably null
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
cruyff UTSW 4 66840326 missense probably damaging 1.00
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense probably damaging 1.00
Lops UTSW 4 66833880 splice acceptor site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.05
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66839444 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66840595 missense probably benign
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTGCCAACATCATCCAGG -3'
(R):5'- GCAAACAGACTGGGTTTAGGC -3'

Sequencing Primer
(F):5'- GAAGGCTTCCACAAGAGCCG -3'
(R):5'- AGGCCCCAGAGTTTTGTTC -3'
Posted OnApr 02, 2015