Incidental Mutation 'R3818:Cyp4a12b'
ID274774
Institutional Source Beutler Lab
Gene Symbol Cyp4a12b
Ensembl Gene ENSMUSG00000078597
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 12B
Synonyms
MMRRC Submission 040772-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.036) question?
Stock #R3818 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115411624-115439034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115432470 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 178 (D178V)
Ref Sequence ENSEMBL: ENSMUSP00000092487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094887]
Predicted Effect probably damaging
Transcript: ENSMUST00000094887
AA Change: D178V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092487
Gene: ENSMUSG00000078597
AA Change: D178V

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:p450 51 503 1.9e-132 PFAM
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T C 10: 80,319,517 D54G probably damaging Het
Adra2b G T 2: 127,363,835 E86* probably null Het
Cachd1 A T 4: 100,990,865 D1059V probably damaging Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Col25a1 A G 3: 130,550,071 K396R possibly damaging Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a30b G T 4: 115,459,009 A311S probably damaging Het
Dse T C 10: 34,153,433 I554V probably benign Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gpr21 C A 2: 37,518,312 T290N probably damaging Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Mamdc4 C T 2: 25,565,773 S840N probably benign Het
Olfr1104 G A 2: 87,021,710 T278I probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Pah A G 10: 87,522,004 probably benign Het
Pikfyve T A 1: 65,245,758 S794T probably damaging Het
Plekhn1 T C 4: 156,225,533 H108R probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Prkd1 A T 12: 50,419,884 probably benign Het
Pwp1 C T 10: 85,888,129 P498L possibly damaging Het
Rasa4 A G 5: 136,102,293 T414A possibly damaging Het
Rbm26 A T 14: 105,141,270 L594I probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Sorcs3 A G 19: 48,603,904 N336S probably benign Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Tlr4 A G 4: 66,841,316 E782G probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttl T C 2: 129,092,994 V358A probably damaging Het
Wdhd1 A G 14: 47,243,801 probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp939 T C 7: 39,473,368 noncoding transcript Het
Other mutations in Cyp4a12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cyp4a12b APN 4 115438049 splice site probably null
IGL01571:Cyp4a12b APN 4 115438157 missense probably benign 0.00
IGL02230:Cyp4a12b APN 4 115433996 missense probably damaging 1.00
IGL02720:Cyp4a12b APN 4 115435171 splice site probably benign
IGL03118:Cyp4a12b APN 4 115432976 missense possibly damaging 0.54
IGL03389:Cyp4a12b APN 4 115433808 missense possibly damaging 0.90
R0360:Cyp4a12b UTSW 4 115432920 missense probably benign 0.01
R0364:Cyp4a12b UTSW 4 115432920 missense probably benign 0.01
R0844:Cyp4a12b UTSW 4 115432524 missense possibly damaging 0.67
R1226:Cyp4a12b UTSW 4 115432967 missense possibly damaging 0.80
R1232:Cyp4a12b UTSW 4 115432563 missense possibly damaging 0.81
R1372:Cyp4a12b UTSW 4 115432949 missense probably benign 0.08
R1559:Cyp4a12b UTSW 4 115433984 missense probably damaging 0.98
R1782:Cyp4a12b UTSW 4 115433981 missense probably damaging 1.00
R1817:Cyp4a12b UTSW 4 115414062 splice site probably benign
R1941:Cyp4a12b UTSW 4 115438059 missense probably damaging 1.00
R1978:Cyp4a12b UTSW 4 115438145 missense probably benign 0.01
R2063:Cyp4a12b UTSW 4 115433503 missense possibly damaging 0.87
R2109:Cyp4a12b UTSW 4 115432913 missense probably damaging 0.97
R2911:Cyp4a12b UTSW 4 115433526 nonsense probably null
R3791:Cyp4a12b UTSW 4 115434970 missense probably benign 0.01
R3815:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3816:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3817:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R4586:Cyp4a12b UTSW 4 115432506 missense probably damaging 1.00
R5004:Cyp4a12b UTSW 4 115438113 missense probably benign 0.39
R5105:Cyp4a12b UTSW 4 115433761 missense probably damaging 1.00
R5354:Cyp4a12b UTSW 4 115433464 splice site probably null
R5655:Cyp4a12b UTSW 4 115433797 missense probably damaging 1.00
R5814:Cyp4a12b UTSW 4 115432497 missense probably damaging 0.97
R5952:Cyp4a12b UTSW 4 115414517 nonsense probably null
R6004:Cyp4a12b UTSW 4 115433467 missense probably benign 0.35
R6059:Cyp4a12b UTSW 4 115438104 missense possibly damaging 0.94
R6261:Cyp4a12b UTSW 4 115414543 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTAAGTTGACAATGAAAATCAGCC -3'
(R):5'- TCTGCAGTATATCTGAGACAGAATAG -3'

Sequencing Primer
(F):5'- CTTCACAACATCTGATACAGGGAGTC -3'
(R):5'- TCTGAGACAGAATAGAGAATCTTGTG -3'
Posted On2015-04-02