Incidental Mutation 'R3818:Gsdme'
ID274779
Institutional Source Beutler Lab
Gene Symbol Gsdme
Ensembl Gene ENSMUSG00000029821
Gene Namegasdermin E
Synonyms4932441K13Rik, Dfna5h, Dfna5, Fin15, 2310037D07Rik
MMRRC Submission 040772-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3818 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location50188888-50263862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 50219411 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 340 (S340A)
Ref Sequence ENSEMBL: ENSMUSP00000126759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031845] [ENSMUST00000101405] [ENSMUST00000165099] [ENSMUST00000170142]
Predicted Effect probably benign
Transcript: ENSMUST00000031845
AA Change: S340A

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031845
Gene: ENSMUSG00000029821
AA Change: S340A

DomainStartEndE-ValueType
Pfam:Gasdermin 1 473 4.8e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101405
AA Change: S340A

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098952
Gene: ENSMUSG00000029821
AA Change: S340A

DomainStartEndE-ValueType
Pfam:Gasdermin 1 399 2e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165099
AA Change: S340A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130522
Gene: ENSMUSG00000029821
AA Change: S340A

DomainStartEndE-ValueType
Pfam:Gasdermin 1 424 1.7e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170142
AA Change: S340A

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126759
Gene: ENSMUSG00000029821
AA Change: S340A

DomainStartEndE-ValueType
Pfam:Gasdermin 1 473 2.3e-149 PFAM
Meta Mutation Damage Score 0.1332 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hearing impairment is a heterogeneous condition with over 40 loci described. The protein encoded by this gene is expressed in fetal cochlea, however, its function is not known. Nonsyndromic hearing impairment is associated with a mutation in this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal numbers of cochlear hair cell but have normal hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T C 10: 80,319,517 D54G probably damaging Het
Adra2b G T 2: 127,363,835 E86* probably null Het
Cachd1 A T 4: 100,990,865 D1059V probably damaging Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Col25a1 A G 3: 130,550,071 K396R possibly damaging Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Cyp4a30b G T 4: 115,459,009 A311S probably damaging Het
Dse T C 10: 34,153,433 I554V probably benign Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gpr21 C A 2: 37,518,312 T290N probably damaging Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Mamdc4 C T 2: 25,565,773 S840N probably benign Het
Olfr1104 G A 2: 87,021,710 T278I probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Pah A G 10: 87,522,004 probably benign Het
Pikfyve T A 1: 65,245,758 S794T probably damaging Het
Plekhn1 T C 4: 156,225,533 H108R probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Prkd1 A T 12: 50,419,884 probably benign Het
Pwp1 C T 10: 85,888,129 P498L possibly damaging Het
Rasa4 A G 5: 136,102,293 T414A possibly damaging Het
Rbm26 A T 14: 105,141,270 L594I probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Sorcs3 A G 19: 48,603,904 N336S probably benign Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Tlr4 A G 4: 66,841,316 E782G probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttl T C 2: 129,092,994 V358A probably damaging Het
Wdhd1 A G 14: 47,243,801 probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp939 T C 7: 39,473,368 noncoding transcript Het
Other mutations in Gsdme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gsdme APN 6 50229284 critical splice donor site probably null
IGL01462:Gsdme APN 6 50227374 missense possibly damaging 0.94
IGL01645:Gsdme APN 6 50251336 missense probably damaging 1.00
IGL01836:Gsdme APN 6 50222789 missense probably damaging 1.00
R0060:Gsdme UTSW 6 50221029 missense possibly damaging 0.73
R0060:Gsdme UTSW 6 50221029 missense possibly damaging 0.73
R0110:Gsdme UTSW 6 50246127 splice site probably benign
R0396:Gsdme UTSW 6 50221107 missense probably benign 0.00
R0510:Gsdme UTSW 6 50246127 splice site probably benign
R0627:Gsdme UTSW 6 50229279 splice site probably benign
R1350:Gsdme UTSW 6 50246128 splice site probably null
R1992:Gsdme UTSW 6 50208122 missense probably damaging 1.00
R2869:Gsdme UTSW 6 50208177 nonsense probably null
R2869:Gsdme UTSW 6 50208177 nonsense probably null
R2973:Gsdme UTSW 6 50229324 missense probably damaging 1.00
R2974:Gsdme UTSW 6 50229324 missense probably damaging 1.00
R3154:Gsdme UTSW 6 50251363 missense probably damaging 0.99
R3816:Gsdme UTSW 6 50219411 missense probably benign 0.41
R3819:Gsdme UTSW 6 50219411 missense probably benign 0.41
R4035:Gsdme UTSW 6 50229448 missense possibly damaging 0.50
R4519:Gsdme UTSW 6 50229353 missense probably damaging 1.00
R4669:Gsdme UTSW 6 50208122 missense probably damaging 1.00
R4678:Gsdme UTSW 6 50229324 missense possibly damaging 0.87
R5009:Gsdme UTSW 6 50246012 missense possibly damaging 0.64
R5370:Gsdme UTSW 6 50229306 missense probably damaging 0.98
R5768:Gsdme UTSW 6 50219300 nonsense probably null
R5811:Gsdme UTSW 6 50245945 missense probably benign 0.02
R5975:Gsdme UTSW 6 50227359 missense probably benign 0.30
R6032:Gsdme UTSW 6 50245954 missense probably damaging 1.00
R6032:Gsdme UTSW 6 50245954 missense probably damaging 1.00
R6035:Gsdme UTSW 6 50229326 missense probably damaging 0.99
R6035:Gsdme UTSW 6 50229326 missense probably damaging 0.99
R6089:Gsdme UTSW 6 50251305 missense probably damaging 0.99
R6565:Gsdme UTSW 6 50229449 missense probably damaging 0.97
R6862:Gsdme UTSW 6 50227398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACTATTTCCCAGCCCTG -3'
(R):5'- GGGCTCAGTGCTTGCTTTAC -3'

Sequencing Primer
(F):5'- GGTTTCCATACCTGCTAGTGCG -3'
(R):5'- CTTTACCTGGAGAGCGTAATGC -3'
Posted On2015-04-02