Incidental Mutation 'R3818:Zfp939'
ID274782
Institutional Source Beutler Lab
Gene Symbol Zfp939
Ensembl Gene ENSMUSG00000030424
Gene Namezinc finger protein 939
Synonyms9430025M13Rik
MMRRC Submission 040772-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock #R3818 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location39449518-39477413 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 39473368 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000061201
SMART Domains Protein: ENSMUSP00000049726
Gene: ENSMUSG00000030424

DomainStartEndE-ValueType
KRAB 4 64 9.45e-34 SMART
ZnF_C2H2 221 243 1.1e-2 SMART
ZnF_C2H2 249 271 2.09e-3 SMART
ZnF_C2H2 277 299 8.94e-3 SMART
ZnF_C2H2 305 327 1.53e-1 SMART
ZnF_C2H2 333 355 4.79e-3 SMART
ZnF_C2H2 361 383 1.25e-1 SMART
ZnF_C2H2 389 411 7.37e-4 SMART
ZnF_C2H2 417 439 2.91e-2 SMART
ZnF_C2H2 445 467 6.42e-4 SMART
ZnF_C2H2 473 495 1.58e-3 SMART
ZnF_C2H2 501 523 1.2e-3 SMART
ZnF_C2H2 529 551 1.53e-1 SMART
ZnF_C2H2 557 579 3.63e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186855
Meta Mutation Damage Score 0.508 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T C 10: 80,319,517 D54G probably damaging Het
Adra2b G T 2: 127,363,835 E86* probably null Het
Cachd1 A T 4: 100,990,865 D1059V probably damaging Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Col25a1 A G 3: 130,550,071 K396R possibly damaging Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Cyp4a30b G T 4: 115,459,009 A311S probably damaging Het
Dse T C 10: 34,153,433 I554V probably benign Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gpr21 C A 2: 37,518,312 T290N probably damaging Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Mamdc4 C T 2: 25,565,773 S840N probably benign Het
Olfr1104 G A 2: 87,021,710 T278I probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Pah A G 10: 87,522,004 probably benign Het
Pikfyve T A 1: 65,245,758 S794T probably damaging Het
Plekhn1 T C 4: 156,225,533 H108R probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Prkd1 A T 12: 50,419,884 probably benign Het
Pwp1 C T 10: 85,888,129 P498L possibly damaging Het
Rasa4 A G 5: 136,102,293 T414A possibly damaging Het
Rbm26 A T 14: 105,141,270 L594I probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Sorcs3 A G 19: 48,603,904 N336S probably benign Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Tlr4 A G 4: 66,841,316 E782G probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttl T C 2: 129,092,994 V358A probably damaging Het
Wdhd1 A G 14: 47,243,801 probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Other mutations in Zfp939
AlleleSourceChrCoordTypePredicted EffectPPH Score
sandiego UTSW 7 39473271 exon noncoding transcript
R0083:Zfp939 UTSW 7 39474110 exon noncoding transcript
R0669:Zfp939 UTSW 7 39473785 exon noncoding transcript
R1166:Zfp939 UTSW 7 39473339 exon noncoding transcript
R1603:Zfp939 UTSW 7 39473271 exon noncoding transcript
R1868:Zfp939 UTSW 7 39473304 exon noncoding transcript
R4358:Zfp939 UTSW 7 39473720 exon noncoding transcript
R4697:Zfp939 UTSW 7 39472942 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TCAGGACGTGGGAAAGCTTC -3'
(R):5'- ATGAATCCTCTGGTGTCTAGTGAG -3'

Sequencing Primer
(F):5'- GCCCTACAAATGTCTAGAATGTGG -3'
(R):5'- TGCGCTGAAAGAGAACGTTTTCC -3'
Posted On2015-04-02