Incidental Mutation 'R3818:Olfr483'
ID274784
Institutional Source Beutler Lab
Gene Symbol Olfr483
Ensembl Gene ENSMUSG00000078118
Gene Nameolfactory receptor 483
SynonymsMOR204-12, GA_x6K02T2PBJ9-10432095-10433042
MMRRC Submission 040772-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R3818 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108100849-108105944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108103498 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 63 (Y63C)
Ref Sequence ENSEMBL: ENSMUSP00000150898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104917] [ENSMUST00000215159]
Predicted Effect possibly damaging
Transcript: ENSMUST00000104917
AA Change: Y63C

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100517
Gene: ENSMUSG00000078118
AA Change: Y63C

DomainStartEndE-ValueType
Pfam:7tm_4 34 312 1.6e-51 PFAM
Pfam:7tm_1 44 294 2.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209740
AA Change: Y63C
Predicted Effect possibly damaging
Transcript: ENSMUST00000215159
AA Change: Y63C

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.354 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T C 10: 80,319,517 D54G probably damaging Het
Adra2b G T 2: 127,363,835 E86* probably null Het
Cachd1 A T 4: 100,990,865 D1059V probably damaging Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Col25a1 A G 3: 130,550,071 K396R possibly damaging Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Cyp4a30b G T 4: 115,459,009 A311S probably damaging Het
Dse T C 10: 34,153,433 I554V probably benign Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gpr21 C A 2: 37,518,312 T290N probably damaging Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Mamdc4 C T 2: 25,565,773 S840N probably benign Het
Olfr1104 G A 2: 87,021,710 T278I probably benign Het
Pah A G 10: 87,522,004 probably benign Het
Pikfyve T A 1: 65,245,758 S794T probably damaging Het
Plekhn1 T C 4: 156,225,533 H108R probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Prkd1 A T 12: 50,419,884 probably benign Het
Pwp1 C T 10: 85,888,129 P498L possibly damaging Het
Rasa4 A G 5: 136,102,293 T414A possibly damaging Het
Rbm26 A T 14: 105,141,270 L594I probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Sorcs3 A G 19: 48,603,904 N336S probably benign Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Tlr4 A G 4: 66,841,316 E782G probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttl T C 2: 129,092,994 V358A probably damaging Het
Wdhd1 A G 14: 47,243,801 probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp939 T C 7: 39,473,368 noncoding transcript Het
Other mutations in Olfr483
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Olfr483 APN 7 108103644 missense probably benign
IGL03028:Olfr483 APN 7 108104173 missense probably damaging 0.99
IGL03275:Olfr483 APN 7 108103608 missense probably damaging 1.00
R0671:Olfr483 UTSW 7 108104156 nonsense probably null
R1403:Olfr483 UTSW 7 108103615 missense probably benign 0.06
R1403:Olfr483 UTSW 7 108103615 missense probably benign 0.06
R1646:Olfr483 UTSW 7 108103591 missense probably benign 0.03
R1655:Olfr483 UTSW 7 108103464 missense probably damaging 1.00
R2334:Olfr483 UTSW 7 108103348 missense probably benign 0.02
R2904:Olfr483 UTSW 7 108103599 missense probably benign 0.12
R3816:Olfr483 UTSW 7 108103498 missense possibly damaging 0.90
R3817:Olfr483 UTSW 7 108103498 missense possibly damaging 0.90
R3819:Olfr483 UTSW 7 108103498 missense possibly damaging 0.90
R5828:Olfr483 UTSW 7 108103798 missense possibly damaging 0.51
R5949:Olfr483 UTSW 7 108104197 missense probably damaging 1.00
R6120:Olfr483 UTSW 7 108104133 missense probably damaging 1.00
R6143:Olfr483 UTSW 7 108104128 missense probably damaging 0.96
R6505:Olfr483 UTSW 7 108103567 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGATGTGGCAGTGACTACAC -3'
(R):5'- GCGATCATAAGCCATGGCAG -3'

Sequencing Primer
(F):5'- TTTCCTGCAGGATGGGAACC -3'
(R):5'- TGGCAGCCAAAAGGAAGCATTC -3'
Posted On2015-04-02