Incidental Mutation 'R3818:Pwp1'
ID274789
Institutional Source Beutler Lab
Gene Symbol Pwp1
Ensembl Gene ENSMUSG00000001785
Gene NamePWP1 homolog, endonuclein
Synonyms2610205J09Rik, 2310058A11Rik
MMRRC Submission 040772-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3818 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location85829494-85889096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85888129 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 498 (P498L)
Ref Sequence ENSEMBL: ENSMUSP00000001836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001836] [ENSMUST00000037646] [ENSMUST00000219370] [ENSMUST00000220032]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001836
AA Change: P498L

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001836
Gene: ENSMUSG00000001785
AA Change: P498L

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Blast:WD40 168 220 4e-27 BLAST
WD40 244 284 4.51e-7 SMART
WD40 287 327 3.37e-6 SMART
WD40 331 370 4.42e1 SMART
WD40 373 413 6.38e-7 SMART
Blast:WD40 418 458 3e-23 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000037646
SMART Domains Protein: ENSMUSP00000041942
Gene: ENSMUSG00000035529

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 51 69 N/A INTRINSIC
low complexity region 339 353 N/A INTRINSIC
PDB:3DB5|B 386 543 2e-98 PDB
Blast:SET 408 538 5e-82 BLAST
ZnF_C2H2 548 569 7.77e1 SMART
low complexity region 575 588 N/A INTRINSIC
ZnF_C2H2 593 615 3.78e-1 SMART
ZnF_C2H2 621 643 2.27e-4 SMART
ZnF_C2H2 649 671 8.02e-5 SMART
ZnF_C2H2 677 699 3.63e-3 SMART
ZnF_C2H2 705 727 3.11e-2 SMART
ZnF_C2H2 733 753 1.81e1 SMART
low complexity region 759 780 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164562
Predicted Effect probably benign
Transcript: ENSMUST00000219370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219902
Predicted Effect probably benign
Transcript: ENSMUST00000220032
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains several WD-40 repeats and is found mostly in the nucleus. The expression and localization of this protein are cell cycle dependent. Expression of this gene is upregulated in pancreatic adenocarcinoma. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T C 10: 80,319,517 D54G probably damaging Het
Adra2b G T 2: 127,363,835 E86* probably null Het
Cachd1 A T 4: 100,990,865 D1059V probably damaging Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Col25a1 A G 3: 130,550,071 K396R possibly damaging Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Cyp4a30b G T 4: 115,459,009 A311S probably damaging Het
Dse T C 10: 34,153,433 I554V probably benign Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gpr21 C A 2: 37,518,312 T290N probably damaging Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Mamdc4 C T 2: 25,565,773 S840N probably benign Het
Olfr1104 G A 2: 87,021,710 T278I probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Pah A G 10: 87,522,004 probably benign Het
Pikfyve T A 1: 65,245,758 S794T probably damaging Het
Plekhn1 T C 4: 156,225,533 H108R probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Prkd1 A T 12: 50,419,884 probably benign Het
Rasa4 A G 5: 136,102,293 T414A possibly damaging Het
Rbm26 A T 14: 105,141,270 L594I probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Sorcs3 A G 19: 48,603,904 N336S probably benign Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Tlr4 A G 4: 66,841,316 E782G probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttl T C 2: 129,092,994 V358A probably damaging Het
Wdhd1 A G 14: 47,243,801 probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp939 T C 7: 39,473,368 noncoding transcript Het
Other mutations in Pwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:Pwp1 APN 10 85878516 missense probably damaging 1.00
IGL00778:Pwp1 APN 10 85879888 missense probably benign 0.05
IGL01086:Pwp1 APN 10 85879893 unclassified probably null
IGL02526:Pwp1 APN 10 85882103 unclassified probably null
IGL02596:Pwp1 APN 10 85872018 unclassified probably null
IGL03164:Pwp1 APN 10 85878503 missense probably benign 0.19
IGL03269:Pwp1 APN 10 85882904 missense probably damaging 0.98
Annuals UTSW 10 85876514 missense probably damaging 1.00
R0031:Pwp1 UTSW 10 85885896 missense probably benign 0.20
R0049:Pwp1 UTSW 10 85885616 missense possibly damaging 0.67
R0049:Pwp1 UTSW 10 85885616 missense possibly damaging 0.67
R0766:Pwp1 UTSW 10 85879309 missense probably damaging 0.98
R0926:Pwp1 UTSW 10 85876514 missense probably damaging 1.00
R1238:Pwp1 UTSW 10 85885862 missense probably benign 0.02
R1312:Pwp1 UTSW 10 85879309 missense probably damaging 0.98
R1420:Pwp1 UTSW 10 85876538 missense probably damaging 1.00
R3177:Pwp1 UTSW 10 85882079 missense probably benign 0.45
R3277:Pwp1 UTSW 10 85882079 missense probably benign 0.45
R4008:Pwp1 UTSW 10 85882034 missense possibly damaging 0.60
R5964:Pwp1 UTSW 10 85882886 missense probably damaging 1.00
R6252:Pwp1 UTSW 10 85874509 missense probably benign 0.00
R6280:Pwp1 UTSW 10 85874462 missense probably damaging 0.99
R6765:Pwp1 UTSW 10 85884533 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATCAGGCTTCCAGGTTG -3'
(R):5'- TACAGTACCCAGTAGAAGGCAG -3'

Sequencing Primer
(F):5'- ATCAGGCTTCCAGGTTGGCTAC -3'
(R):5'- CCAGTAGAAGGCAGCCCAAAG -3'
Posted On2015-04-02