Incidental Mutation 'R3818:Pah'
ID274790
Institutional Source Beutler Lab
Gene Symbol Pah
Ensembl Gene ENSMUSG00000020051
Gene Namephenylalanine hydroxylase
SynonymsAW106920, OTTMUSP00000027786, PH, PKU, PKU1
MMRRC Submission 040772-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R3818 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location87521795-87584136 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to G at 87522004 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020241] [ENSMUST00000219813]
Predicted Effect probably benign
Transcript: ENSMUST00000020241
SMART Domains Protein: ENSMUSP00000020241
Gene: ENSMUSG00000020051

DomainStartEndE-ValueType
Pfam:ACT 35 100 1.8e-10 PFAM
Pfam:Biopterin_H 119 449 1.3e-177 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000120429
Gene: ENSMUSG00000020051

DomainStartEndE-ValueType
PDB:2PHM|A 1 52 1e-27 PDB
SCOP:d1phza1 19 52 3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218573
Predicted Effect probably benign
Transcript: ENSMUST00000219813
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAH encodes the enzyme phenylalanine hydroxylase that is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for ENU-induced mutations of this gene have altered serum and urine phenylalanine levels and may display reduced body size, microcephaly, microphthalmia, decreased litter size, hypopigmentation, impaired balance/swimming, cognitive deficits, and environmentally-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T C 10: 80,319,517 D54G probably damaging Het
Adra2b G T 2: 127,363,835 E86* probably null Het
Cachd1 A T 4: 100,990,865 D1059V probably damaging Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Col25a1 A G 3: 130,550,071 K396R possibly damaging Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Cyp4a30b G T 4: 115,459,009 A311S probably damaging Het
Dse T C 10: 34,153,433 I554V probably benign Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gpr21 C A 2: 37,518,312 T290N probably damaging Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Mamdc4 C T 2: 25,565,773 S840N probably benign Het
Olfr1104 G A 2: 87,021,710 T278I probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Pikfyve T A 1: 65,245,758 S794T probably damaging Het
Plekhn1 T C 4: 156,225,533 H108R probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Prkd1 A T 12: 50,419,884 probably benign Het
Pwp1 C T 10: 85,888,129 P498L possibly damaging Het
Rasa4 A G 5: 136,102,293 T414A possibly damaging Het
Rbm26 A T 14: 105,141,270 L594I probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Sorcs3 A G 19: 48,603,904 N336S probably benign Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Tlr4 A G 4: 66,841,316 E782G probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttl T C 2: 129,092,994 V358A probably damaging Het
Wdhd1 A G 14: 47,243,801 probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp939 T C 7: 39,473,368 noncoding transcript Het
Other mutations in Pah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Pah APN 10 87578893 missense probably benign 0.02
IGL00823:Pah APN 10 87570331 missense probably null 1.00
IGL01350:Pah APN 10 87578359 intron probably benign
IGL01668:Pah APN 10 87578261 missense probably damaging 1.00
IGL01794:Pah APN 10 87578922 missense possibly damaging 0.63
IGL01956:Pah APN 10 87538199 missense probably benign 0.03
IGL01985:Pah APN 10 87578982 missense probably damaging 1.00
IGL02014:Pah APN 10 87581927 missense probably benign 0.00
IGL02552:Pah APN 10 87578845 intron probably benign
IGL03096:Pah APN 10 87538242 critical splice donor site probably null
bronze UTSW 10 87570226 missense probably damaging 1.00
R0238:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0239:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0239:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0839:Pah UTSW 10 87522062 missense probably damaging 1.00
R0853:Pah UTSW 10 87576218 splice site probably null
R1474:Pah UTSW 10 87578313 missense probably damaging 1.00
R1762:Pah UTSW 10 87567468 missense possibly damaging 0.91
R1886:Pah UTSW 10 87528328 missense possibly damaging 0.91
R2179:Pah UTSW 10 87567335 missense probably damaging 1.00
R2852:Pah UTSW 10 87567465 missense probably damaging 1.00
R4509:Pah UTSW 10 87576215 critical splice donor site probably null
R4725:Pah UTSW 10 87554376 missense probably damaging 1.00
R4911:Pah UTSW 10 87570267 missense probably benign 0.42
R5094:Pah UTSW 10 87538219 nonsense probably null
R5766:Pah UTSW 10 87567347 missense probably damaging 1.00
R6210:Pah UTSW 10 87583561 missense probably benign 0.01
R6273:Pah UTSW 10 87576215 critical splice donor site probably null
R6345:Pah UTSW 10 87576187 missense probably damaging 1.00
R6349:Pah UTSW 10 87578969 missense probably benign 0.01
Z1088:Pah UTSW 10 87571291 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTATCCACTGCTACGTCAGGG -3'
(R):5'- CTCATCAGTTGACTTCCTGGG -3'

Sequencing Primer
(F):5'- TGCTACGTCAGGGCAACAC -3'
(R):5'- GGCATTTTCCTCGCCTCTAAATAAAG -3'
Posted On2015-04-02