Mutagenetix > Incidental Mutation

Incidental Mutation 'R3818:Sorcs3'

274796

Institutional Source

Beutler Lab

Gene Symbol

Sorcs3

Ensembl Gene

ENSMUSG00000063434

Gene Name

sortilin-related VPS10 domain containing receptor 3

Synonyms

6330404A12Rik

MMRRC Submission

040772-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R3818 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48194464-48793944 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 48592343 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 336 (N336S)

Ref Sequence

ENSEMBL: ENSMUSP00000077919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078880]

AlphaFold

Q8VI51

Predicted Effect

probably benign
Transcript: ENSMUST00000078880
AA Change: N336S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: N336S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	46	63	N/A	INTRINSIC
low complexity region	69	91	N/A	INTRINSIC
VPS10	216	818	N/A	SMART
Pfam:PKD	823	901	8e-13	PFAM
transmembrane domain	1122	1141	N/A	INTRINSIC

Meta Mutation Damage Score

0.0848

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.4%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310011J03Rik	T	C	10: 80,155,351 (GRCm39)	D54G	probably damaging	Het
Adra2b	G	T	2: 127,205,755 (GRCm39)	E86*	probably null	Het
Cachd1	A	T	4: 100,848,062 (GRCm39)	D1059V	probably damaging	Het
Cd177	A	G	7: 24,453,817 (GRCm39)	V358A	probably benign	Het
Col25a1	A	G	3: 130,343,720 (GRCm39)	K396R	possibly damaging	Het
Csmd1	C	T	8: 16,052,522 (GRCm39)	A2201T	probably damaging	Het
Cyp4a12b	A	T	4: 115,289,667 (GRCm39)	D178V	probably damaging	Het
Cyp4a30b	G	T	4: 115,316,206 (GRCm39)	A311S	probably damaging	Het
Dse	T	C	10: 34,029,429 (GRCm39)	I554V	probably benign	Het
Gabrg3	G	A	7: 57,031,412 (GRCm39)	Q43*	probably null	Het
Gjb2	A	G	14: 57,337,530 (GRCm39)	V226A	probably benign	Het
Gpr21	C	A	2: 37,408,324 (GRCm39)	T290N	probably damaging	Het
Gsdme	A	C	6: 50,196,391 (GRCm39)	S340A	probably benign	Het
Hivep2	T	C	10: 14,019,685 (GRCm39)	V2152A	possibly damaging	Het
Mamdc4	C	T	2: 25,455,785 (GRCm39)	S840N	probably benign	Het
Or5p59	A	G	7: 107,702,705 (GRCm39)	Y63C	possibly damaging	Het
Or8i2	G	A	2: 86,852,054 (GRCm39)	T278I	probably benign	Het
Pah	A	G	10: 87,357,866 (GRCm39)		probably benign	Het
Pikfyve	T	A	1: 65,284,917 (GRCm39)	S794T	probably damaging	Het
Plekhn1	T	C	4: 156,309,990 (GRCm39)	H108R	probably damaging	Het
Pomgnt1	T	A	4: 116,011,139 (GRCm39)		probably null	Het
Prkd1	A	T	12: 50,466,667 (GRCm39)		probably benign	Het
Pwp1	C	T	10: 85,723,993 (GRCm39)	P498L	possibly damaging	Het
Rasa4	A	G	5: 136,131,147 (GRCm39)	T414A	possibly damaging	Het
Rbm26	A	T	14: 105,378,706 (GRCm39)	L594I	probably damaging	Het
Rufy4	T	C	1: 74,186,822 (GRCm39)	C537R	probably damaging	Het
Skint5	A	G	4: 113,486,319 (GRCm39)		probably benign	Het
Sspo	A	T	6: 48,458,037 (GRCm39)	E3269V	possibly damaging	Het
Tlr4	A	G	4: 66,759,553 (GRCm39)	E782G	probably benign	Het
Tnfrsf11a	C	T	1: 105,737,085 (GRCm39)	T64I	probably damaging	Het
Top2b	T	G	14: 16,409,189 (GRCm38)	I777M	probably damaging	Het
Ttl	T	C	2: 128,934,914 (GRCm39)	V358A	probably damaging	Het
Wdhd1	A	G	14: 47,481,258 (GRCm39)		probably null	Het
Wdr37	A	G	13: 8,903,632 (GRCm39)		probably benign	Het
Zfp939	T	C	7: 39,122,792 (GRCm39)		noncoding transcript	Het

Other mutations in Sorcs3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sorcs3	APN	19	48,672,097 (GRCm39)	critical splice donor site	probably null
IGL00233:Sorcs3	APN	19	48,736,758 (GRCm39)	missense	probably benign	0.12
IGL00482:Sorcs3	APN	19	48,592,303 (GRCm39)	missense	probably benign	0.00
IGL00976:Sorcs3	APN	19	48,755,542 (GRCm39)	missense	probably damaging	1.00
IGL01367:Sorcs3	APN	19	48,784,814 (GRCm39)	missense	probably damaging	1.00
IGL01390:Sorcs3	APN	19	48,778,570 (GRCm39)	missense	probably damaging	1.00
IGL01548:Sorcs3	APN	19	48,782,607 (GRCm39)	missense	possibly damaging	0.87
IGL02162:Sorcs3	APN	19	48,523,970 (GRCm39)	missense	probably damaging	0.98
IGL02165:Sorcs3	APN	19	48,642,511 (GRCm39)	missense	probably benign	0.03
IGL02404:Sorcs3	APN	19	48,692,809 (GRCm39)	splice site	probably benign
IGL02830:Sorcs3	APN	19	48,711,441 (GRCm39)	splice site	probably null
IGL02943:Sorcs3	APN	19	48,748,377 (GRCm39)	missense	probably benign	0.00
R0371:Sorcs3	UTSW	19	48,592,333 (GRCm39)	missense	probably benign	0.00
R0456:Sorcs3	UTSW	19	48,642,483 (GRCm39)	missense	possibly damaging	0.94
R0466:Sorcs3	UTSW	19	48,736,758 (GRCm39)	missense	probably benign	0.12
R0470:Sorcs3	UTSW	19	48,785,956 (GRCm39)	critical splice donor site	probably null
R0536:Sorcs3	UTSW	19	48,791,137 (GRCm39)	nonsense	probably null
R0646:Sorcs3	UTSW	19	48,194,734 (GRCm39)	missense	probably benign	0.10
R0709:Sorcs3	UTSW	19	48,475,845 (GRCm39)	missense	probably benign
R0792:Sorcs3	UTSW	19	48,694,448 (GRCm39)	missense	possibly damaging	0.84
R0831:Sorcs3	UTSW	19	48,682,433 (GRCm39)	missense	probably damaging	1.00
R0836:Sorcs3	UTSW	19	48,475,833 (GRCm39)	missense	probably benign
R1253:Sorcs3	UTSW	19	48,195,175 (GRCm39)	missense	possibly damaging	0.67
R1390:Sorcs3	UTSW	19	48,682,440 (GRCm39)	critical splice donor site	probably null
R1522:Sorcs3	UTSW	19	48,694,448 (GRCm39)	missense	possibly damaging	0.84
R1570:Sorcs3	UTSW	19	48,752,620 (GRCm39)	missense	probably damaging	1.00
R1637:Sorcs3	UTSW	19	48,736,798 (GRCm39)	critical splice donor site	probably null
R1766:Sorcs3	UTSW	19	48,592,314 (GRCm39)	missense	possibly damaging	0.87
R1894:Sorcs3	UTSW	19	48,782,713 (GRCm39)	missense	probably benign	0.23
R2426:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R3789:Sorcs3	UTSW	19	48,387,150 (GRCm39)	missense	possibly damaging	0.46
R3824:Sorcs3	UTSW	19	48,711,395 (GRCm39)	missense	probably damaging	1.00
R3934:Sorcs3	UTSW	19	48,701,943 (GRCm39)	missense	probably damaging	1.00
R3936:Sorcs3	UTSW	19	48,701,943 (GRCm39)	missense	probably damaging	1.00
R4190:Sorcs3	UTSW	19	48,737,812 (GRCm39)	missense	possibly damaging	0.69
R4604:Sorcs3	UTSW	19	48,682,353 (GRCm39)	missense	probably benign	0.35
R4644:Sorcs3	UTSW	19	48,672,036 (GRCm39)	missense	probably damaging	1.00
R4774:Sorcs3	UTSW	19	48,782,602 (GRCm39)	missense	probably benign	0.23
R4801:Sorcs3	UTSW	19	48,387,183 (GRCm39)	missense	possibly damaging	0.46
R4802:Sorcs3	UTSW	19	48,387,183 (GRCm39)	missense	possibly damaging	0.46
R4945:Sorcs3	UTSW	19	48,752,587 (GRCm39)	missense	possibly damaging	0.50
R5049:Sorcs3	UTSW	19	48,748,390 (GRCm39)	missense	possibly damaging	0.93
R5175:Sorcs3	UTSW	19	48,748,284 (GRCm39)	critical splice acceptor site	probably null
R5342:Sorcs3	UTSW	19	48,784,911 (GRCm39)	splice site	probably null
R5848:Sorcs3	UTSW	19	48,776,950 (GRCm39)	missense	probably damaging	1.00
R5959:Sorcs3	UTSW	19	48,737,835 (GRCm39)	missense	probably damaging	1.00
R5977:Sorcs3	UTSW	19	48,784,889 (GRCm39)	missense	probably damaging	1.00
R6155:Sorcs3	UTSW	19	48,387,136 (GRCm39)	missense	possibly damaging	0.94
R6222:Sorcs3	UTSW	19	48,748,296 (GRCm39)	missense	possibly damaging	0.57
R6268:Sorcs3	UTSW	19	48,778,605 (GRCm39)	missense	probably damaging	1.00
R6416:Sorcs3	UTSW	19	48,791,198 (GRCm39)	missense	probably damaging	1.00
R6425:Sorcs3	UTSW	19	48,752,746 (GRCm39)	critical splice donor site	probably null
R6623:Sorcs3	UTSW	19	48,776,944 (GRCm39)	missense	probably benign	0.00
R6767:Sorcs3	UTSW	19	48,702,010 (GRCm39)	missense	probably damaging	0.99
R6888:Sorcs3	UTSW	19	48,682,263 (GRCm39)	missense	possibly damaging	0.83
R6955:Sorcs3	UTSW	19	48,737,782 (GRCm39)	missense	possibly damaging	0.82
R7106:Sorcs3	UTSW	19	48,694,402 (GRCm39)	missense	probably damaging	1.00
R7379:Sorcs3	UTSW	19	48,760,705 (GRCm39)	missense	possibly damaging	0.69
R7953:Sorcs3	UTSW	19	48,752,734 (GRCm39)	missense	possibly damaging	0.84
R8043:Sorcs3	UTSW	19	48,752,734 (GRCm39)	missense	possibly damaging	0.84
R8242:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8343:Sorcs3	UTSW	19	48,692,808 (GRCm39)	splice site	probably null
R8433:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8435:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8436:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8940:Sorcs3	UTSW	19	48,784,908 (GRCm39)	critical splice donor site	probably null
R8956:Sorcs3	UTSW	19	48,737,810 (GRCm39)	nonsense	probably null
R9051:Sorcs3	UTSW	19	48,194,809 (GRCm39)	missense	probably benign
R9119:Sorcs3	UTSW	19	48,642,433 (GRCm39)	missense	possibly damaging	0.92
R9166:Sorcs3	UTSW	19	48,784,811 (GRCm39)	missense	probably benign	0.01
R9328:Sorcs3	UTSW	19	48,785,950 (GRCm39)	missense	probably damaging	1.00
R9489:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R9605:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R9757:Sorcs3	UTSW	19	48,711,363 (GRCm39)	missense	probably damaging	1.00
X0018:Sorcs3	UTSW	19	48,760,728 (GRCm39)	missense	probably damaging	1.00
Z1176:Sorcs3	UTSW	19	48,634,243 (GRCm39)	missense	probably damaging	1.00
Z1177:Sorcs3	UTSW	19	48,692,739 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTATCTACTTTACTGATCCTGAGTCC -3'
(R):5'- AGCACCTAGTGACAAGCCTTC -3'

Sequencing Primer
(F):5'- ACTGATCCTGAGTCCTGTCATTAG -3'
(R):5'- AAGTGCCCAGGAATCGTGTTC -3'

Posted On

2015-04-02