Incidental Mutation 'R3820:Serpinb5'
ID274840
Institutional Source Beutler Lab
Gene Symbol Serpinb5
Ensembl Gene ENSMUSG00000067006
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 5
Synonymsovalbumin, 1110036M19Rik, Maspin, Spi7
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location106861173-106883348 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 106875072 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 112 (Y112*)
Ref Sequence ENSEMBL: ENSMUSP00000108350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086701] [ENSMUST00000112729] [ENSMUST00000112730] [ENSMUST00000188745]
Predicted Effect probably null
Transcript: ENSMUST00000086701
AA Change: Y112*
SMART Domains Protein: ENSMUSP00000083908
Gene: ENSMUSG00000067006
AA Change: Y112*

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112729
AA Change: Y112*
SMART Domains Protein: ENSMUSP00000108349
Gene: ENSMUSG00000067006
AA Change: Y112*

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112730
AA Change: Y112*
SMART Domains Protein: ENSMUSP00000108350
Gene: ENSMUSG00000067006
AA Change: Y112*

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188745
SMART Domains Protein: ENSMUSP00000140264
Gene: ENSMUSG00000067006

DomainStartEndE-ValueType
Pfam:Serpin 1 74 1.6e-15 PFAM
Meta Mutation Damage Score 0.632 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Mice homozygous for one null allele displayed peri-implantation lethality with impaired endoderm development and attenuated inner cell mass growth. Mice homozygous for another null allele were viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Serpinb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Serpinb5 APN 1 106880326 missense probably benign 0.01
R1385:Serpinb5 UTSW 1 106876123 missense probably damaging 1.00
R1480:Serpinb5 UTSW 1 106881707 missense probably benign
R1497:Serpinb5 UTSW 1 106876052 missense probably benign 0.08
R1503:Serpinb5 UTSW 1 106870289 missense possibly damaging 0.76
R1933:Serpinb5 UTSW 1 106876121 missense probably damaging 0.99
R2400:Serpinb5 UTSW 1 106881952 missense probably damaging 0.98
R2567:Serpinb5 UTSW 1 106875146 missense probably benign 0.33
R2923:Serpinb5 UTSW 1 106876040 missense probably benign
R3148:Serpinb5 UTSW 1 106881825 missense probably damaging 1.00
R4667:Serpinb5 UTSW 1 106872295 missense probably benign 0.00
R4814:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4815:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4816:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4817:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R5369:Serpinb5 UTSW 1 106881757 missense possibly damaging 0.85
R6108:Serpinb5 UTSW 1 106881728 missense probably damaging 1.00
R6222:Serpinb5 UTSW 1 106870340 missense probably benign 0.09
R6251:Serpinb5 UTSW 1 106875065 missense possibly damaging 0.96
R6349:Serpinb5 UTSW 1 106881765 missense probably benign 0.44
R6936:Serpinb5 UTSW 1 106870418 missense probably benign 0.00
R6977:Serpinb5 UTSW 1 106872347 missense probably benign 0.20
R7332:Serpinb5 UTSW 1 106872361 missense probably benign 0.00
R7369:Serpinb5 UTSW 1 106875149 missense probably benign 0.29
R7443:Serpinb5 UTSW 1 106881970 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATACAATGCTTCAGATAATGTGACC -3'
(R):5'- CAGAAAGCCAAGTTGTTGACATG -3'

Sequencing Primer
(F):5'- GCTTCAGATAATGTGACCAATTTTG -3'
(R):5'- CCAAGTTGTTGACATGGCTTG -3'
Posted On2015-04-02