Incidental Mutation 'R3820:Kcnt1'
ID274843
Institutional Source Beutler Lab
Gene Symbol Kcnt1
Ensembl Gene ENSMUSG00000058740
Gene Namepotassium channel, subfamily T, member 1
SynonymsC030030G16Rik, Slack, slo2
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25863734-25918273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25900892 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 486 (H486R)
Ref Sequence ENSEMBL: ENSMUSP00000143106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037580] [ENSMUST00000114172] [ENSMUST00000114176] [ENSMUST00000128502] [ENSMUST00000153001] [ENSMUST00000171268] [ENSMUST00000197917] [ENSMUST00000198204] [ENSMUST00000200434]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037580
AA Change: H486R

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039058
Gene: ENSMUSG00000058740
AA Change: H486R

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 252 335 1.3e-12 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 477 579 5.8e-32 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1212 1229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114172
AA Change: H472R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109809
Gene: ENSMUSG00000058740
AA Change: H472R

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114176
AA Change: H486R

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109813
Gene: ENSMUSG00000058740
AA Change: H486R

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.1e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.2e-38 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128502
AA Change: H1R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138568
Predicted Effect probably benign
Transcript: ENSMUST00000153001
SMART Domains Protein: ENSMUSP00000142532
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
PDB:4HPF|B 79 285 6e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171268
AA Change: H466R

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000132212
Gene: ENSMUSG00000058740
AA Change: H466R

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Ion_trans_2 235 315 5.1e-13 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Pfam:BK_channel_a 455 560 3.2e-38 PFAM
PDB:3U6N|H 774 963 7e-6 PDB
low complexity region 1039 1056 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197917
AA Change: H486R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143106
Gene: ENSMUSG00000058740
AA Change: H486R

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198204
AA Change: H452R

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142870
Gene: ENSMUSG00000058740
AA Change: H452R

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.2e-35 PFAM
PDB:3U6N|H 760 949 6e-6 PDB
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200434
AA Change: H452R

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143482
Gene: ENSMUSG00000058740
AA Change: H452R

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5.1e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.3e-35 PFAM
PDB:3U6N|H 758 947 6e-6 PDB
low complexity region 1023 1040 N/A INTRINSIC
low complexity region 1176 1193 N/A INTRINSIC
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes a member of the Slo potassium channel family that has shown to be activated by both sodium and chloride ions. This channel represents the largest potassium channel subunit yet identified. This channel may be important in development and pain signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired action potential firing in sensory neurons and increased mechanical hypersensitivity in neuropathic pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Kcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Kcnt1 APN 2 25892407 missense probably damaging 0.98
IGL01358:Kcnt1 APN 2 25916005 missense probably damaging 1.00
IGL01593:Kcnt1 APN 2 25898754 missense probably damaging 1.00
IGL01779:Kcnt1 APN 2 25900967 missense probably damaging 1.00
IGL01800:Kcnt1 APN 2 25888125 missense probably damaging 1.00
IGL01834:Kcnt1 APN 2 25912719 critical splice donor site probably null
IGL02001:Kcnt1 APN 2 25908152 missense probably damaging 1.00
IGL02061:Kcnt1 APN 2 25900482 critical splice donor site probably null
IGL02121:Kcnt1 APN 2 25901865 missense probably damaging 1.00
IGL02646:Kcnt1 APN 2 25900880 splice site probably benign
IGL02683:Kcnt1 APN 2 25900925 missense possibly damaging 0.85
IGL03028:Kcnt1 APN 2 25909203 critical splice acceptor site probably null
IGL03139:Kcnt1 APN 2 25894468 splice site probably benign
R0070:Kcnt1 UTSW 2 25892362 missense probably benign 0.00
R0070:Kcnt1 UTSW 2 25892362 missense probably benign 0.00
R0149:Kcnt1 UTSW 2 25898264 splice site probably benign
R0294:Kcnt1 UTSW 2 25888110 missense probably damaging 0.99
R0367:Kcnt1 UTSW 2 25907628 missense probably damaging 1.00
R0481:Kcnt1 UTSW 2 25892496 missense probably damaging 0.98
R0666:Kcnt1 UTSW 2 25891243 splice site probably benign
R1364:Kcnt1 UTSW 2 25908094 missense probably damaging 0.99
R1553:Kcnt1 UTSW 2 25900385 missense probably damaging 1.00
R1916:Kcnt1 UTSW 2 25900469 missense probably damaging 1.00
R1999:Kcnt1 UTSW 2 25892360 missense probably benign
R2079:Kcnt1 UTSW 2 25900248 missense possibly damaging 0.48
R2166:Kcnt1 UTSW 2 25891183 splice site probably benign
R2295:Kcnt1 UTSW 2 25900921 missense probably damaging 1.00
R3688:Kcnt1 UTSW 2 25894359 missense probably damaging 1.00
R3826:Kcnt1 UTSW 2 25915868 critical splice donor site probably null
R3980:Kcnt1 UTSW 2 25893214 missense possibly damaging 0.91
R4031:Kcnt1 UTSW 2 25916048 missense possibly damaging 0.77
R4093:Kcnt1 UTSW 2 25877915 missense probably damaging 0.99
R4361:Kcnt1 UTSW 2 25878032 missense probably benign 0.03
R4367:Kcnt1 UTSW 2 25907626 missense probably damaging 1.00
R4850:Kcnt1 UTSW 2 25908100 missense probably damaging 1.00
R5005:Kcnt1 UTSW 2 25901346 missense probably damaging 1.00
R5119:Kcnt1 UTSW 2 25909322 intron probably benign
R5223:Kcnt1 UTSW 2 25903422 missense probably benign
R5243:Kcnt1 UTSW 2 25908074 missense probably damaging 1.00
R5323:Kcnt1 UTSW 2 25909277 missense possibly damaging 0.59
R5665:Kcnt1 UTSW 2 25901909 nonsense probably null
R5888:Kcnt1 UTSW 2 25908110 missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25894524 intron probably benign
R5906:Kcnt1 UTSW 2 25898401 missense probably damaging 1.00
R5927:Kcnt1 UTSW 2 25909376 intron probably benign
R6160:Kcnt1 UTSW 2 25892383 missense probably damaging 0.96
R6161:Kcnt1 UTSW 2 25903385 missense probably benign 0.00
R6179:Kcnt1 UTSW 2 25893180 missense probably damaging 1.00
R6222:Kcnt1 UTSW 2 25892510 missense probably damaging 1.00
R6268:Kcnt1 UTSW 2 25903597 splice site probably null
R6336:Kcnt1 UTSW 2 25888755 unclassified probably null
R6395:Kcnt1 UTSW 2 25909239 missense possibly damaging 0.81
R6564:Kcnt1 UTSW 2 25911051 missense probably benign 0.09
R6944:Kcnt1 UTSW 2 25877828 intron probably benign
R7308:Kcnt1 UTSW 2 25900463 missense possibly damaging 0.74
R7346:Kcnt1 UTSW 2 25863843 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAATGATCTGTCGTCCCACTG -3'
(R):5'- CCAATTGGTTAAATGCATCCTGC -3'

Sequencing Primer
(F):5'- CTGAACAGACAGGGGCCATG -3'
(R):5'- GACCTCTGCCCACGACATG -3'
Posted On2015-04-02