Incidental Mutation 'R3820:Pds5a'
ID274851
Institutional Source Beutler Lab
Gene Symbol Pds5a
Ensembl Gene ENSMUSG00000029202
Gene NamePDS5 cohesin associated factor A
Synonyms9030416H16Rik, E230024D05Rik
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location65605721-65698273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65654076 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 338 (V338A)
Ref Sequence ENSEMBL: ENSMUSP00000144171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031104] [ENSMUST00000201948]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031104
AA Change: V338A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031104
Gene: ENSMUSG00000029202
AA Change: V338A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 253 782 6e-30 SMART
low complexity region 934 946 N/A INTRINSIC
low complexity region 1174 1190 N/A INTRINSIC
low complexity region 1258 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200790
Predicted Effect possibly damaging
Transcript: ENSMUST00000201948
AA Change: V338A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144171
Gene: ENSMUSG00000029202
AA Change: V338A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 253 782 6e-30 SMART
low complexity region 934 946 N/A INTRINSIC
low complexity region 1174 1190 N/A INTRINSIC
low complexity region 1258 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202698
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the cohesin complex and associates with chromatin through most of the cell cycle. The encoded protein may play a role in regulating sister chromatid cohesion during mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with respiratory distress, abnormal heart development, abnormal skeletal development, kidney agenesis, and delayed enteric nervous system development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Pds5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Pds5a APN 5 65656344 missense probably damaging 1.00
IGL00979:Pds5a APN 5 65631723 missense probably benign 0.22
IGL01314:Pds5a APN 5 65615294 missense probably benign
IGL02449:Pds5a APN 5 65619010 missense probably damaging 1.00
IGL02539:Pds5a APN 5 65666119 missense probably damaging 1.00
IGL03395:Pds5a APN 5 65652449 missense possibly damaging 0.61
R0569:Pds5a UTSW 5 65656401 missense probably damaging 1.00
R0704:Pds5a UTSW 5 65620585 missense probably damaging 1.00
R1170:Pds5a UTSW 5 65635302 splice site probably benign
R1181:Pds5a UTSW 5 65627202 splice site probably null
R1193:Pds5a UTSW 5 65637802 missense probably damaging 1.00
R1537:Pds5a UTSW 5 65647121 missense probably benign 0.09
R1853:Pds5a UTSW 5 65624029 missense possibly damaging 0.56
R2016:Pds5a UTSW 5 65648007 critical splice acceptor site probably null
R2154:Pds5a UTSW 5 65650498 missense probably damaging 1.00
R2209:Pds5a UTSW 5 65628014 nonsense probably null
R2234:Pds5a UTSW 5 65654098 missense probably damaging 1.00
R2235:Pds5a UTSW 5 65654098 missense probably damaging 1.00
R2332:Pds5a UTSW 5 65627079 splice site probably null
R3114:Pds5a UTSW 5 65618985 missense probably damaging 1.00
R3417:Pds5a UTSW 5 65637892 missense probably damaging 0.99
R4152:Pds5a UTSW 5 65666171 nonsense probably null
R4159:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4160:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4161:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4230:Pds5a UTSW 5 65629986 missense possibly damaging 0.85
R4491:Pds5a UTSW 5 65635437 missense probably benign
R4647:Pds5a UTSW 5 65656318 missense probably damaging 1.00
R4816:Pds5a UTSW 5 65651289 missense probably damaging 1.00
R4867:Pds5a UTSW 5 65644120 missense probably damaging 1.00
R5001:Pds5a UTSW 5 65696785 missense probably damaging 0.99
R5013:Pds5a UTSW 5 65635337 missense probably benign 0.05
R5054:Pds5a UTSW 5 65637814 missense probably damaging 1.00
R5068:Pds5a UTSW 5 65615272 missense probably damaging 0.99
R5178:Pds5a UTSW 5 65663875 missense probably damaging 1.00
R5269:Pds5a UTSW 5 65663928 missense probably damaging 1.00
R5396:Pds5a UTSW 5 65638577 missense probably benign 0.09
R5704:Pds5a UTSW 5 65627079 splice site probably null
R5940:Pds5a UTSW 5 65643985 intron probably benign
R6306:Pds5a UTSW 5 65656296 missense probably damaging 1.00
R6322:Pds5a UTSW 5 65696834 missense probably benign 0.00
R6467:Pds5a UTSW 5 65652439 missense probably damaging 1.00
R6476:Pds5a UTSW 5 65634287 missense possibly damaging 0.94
R6513:Pds5a UTSW 5 65615601 missense probably benign 0.18
R7304:Pds5a UTSW 5 65619734 missense probably damaging 1.00
R7312:Pds5a UTSW 5 65666227 missense possibly damaging 0.81
R7438:Pds5a UTSW 5 65652535 critical splice acceptor site probably null
Z1088:Pds5a UTSW 5 65618986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGAACATGAAGCCATCTTG -3'
(R):5'- GGCAAGCATATAACTCTTTGCAAG -3'

Sequencing Primer
(F):5'- TGAAGCCATCTTGCAATCAAATCTC -3'
(R):5'- CTCCAGAGTGCTGCGTGTAAAG -3'
Posted On2015-04-02