Incidental Mutation 'R3820:Micall2'
ID274853
Institutional Source Beutler Lab
Gene Symbol Micall2
Ensembl Gene ENSMUSG00000036718
Gene NameMICAL-like 2
SynonymsA930021H16Rik, Jrab, MICAL-L2
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location139706696-139736336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139715856 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 461 (G461D)
Ref Sequence ENSEMBL: ENSMUSP00000127937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044642] [ENSMUST00000170773]
Predicted Effect unknown
Transcript: ENSMUST00000044642
AA Change: G544D
SMART Domains Protein: ENSMUSP00000039707
Gene: ENSMUSG00000036718
AA Change: G544D

DomainStartEndE-ValueType
CH 3 102 4.34e-20 SMART
LIM 187 241 1.62e-5 SMART
low complexity region 242 253 N/A INTRINSIC
low complexity region 326 344 N/A INTRINSIC
low complexity region 428 489 N/A INTRINSIC
low complexity region 502 518 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 755 770 N/A INTRINSIC
DUF3585 840 980 3.1e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165645
Predicted Effect possibly damaging
Transcript: ENSMUST00000170773
AA Change: G461D

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127937
Gene: ENSMUSG00000036718
AA Change: G461D

DomainStartEndE-ValueType
SCOP:d1bkra_ 1 25 9e-5 SMART
Blast:DUF3585 1 45 2e-7 BLAST
LIM 104 158 1.62e-5 SMART
low complexity region 159 170 N/A INTRINSIC
low complexity region 243 261 N/A INTRINSIC
low complexity region 345 406 N/A INTRINSIC
low complexity region 419 435 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
DUF3585 757 897 3.1e-63 SMART
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Micall2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Micall2 APN 5 139717556 critical splice acceptor site probably null
IGL00496:Micall2 APN 5 139716328 missense probably benign 0.01
IGL02641:Micall2 APN 5 139719339 missense probably damaging 1.00
IGL03245:Micall2 APN 5 139719259 missense probably damaging 1.00
IGL03252:Micall2 APN 5 139716726 missense probably benign 0.01
R1214:Micall2 UTSW 5 139711641 missense probably damaging 0.97
R1468:Micall2 UTSW 5 139719342 missense probably damaging 1.00
R1468:Micall2 UTSW 5 139719342 missense probably damaging 1.00
R1831:Micall2 UTSW 5 139716753 missense probably benign 0.09
R1833:Micall2 UTSW 5 139716753 missense probably benign 0.09
R1969:Micall2 UTSW 5 139736130 missense probably damaging 1.00
R2023:Micall2 UTSW 5 139717511 missense possibly damaging 0.51
R2060:Micall2 UTSW 5 139711562 missense probably damaging 0.98
R2330:Micall2 UTSW 5 139717515 missense probably damaging 1.00
R4299:Micall2 UTSW 5 139709471 intron probably benign
R4334:Micall2 UTSW 5 139713350 missense probably damaging 1.00
R4451:Micall2 UTSW 5 139707097 missense probably damaging 1.00
R4769:Micall2 UTSW 5 139706886 missense probably damaging 0.97
R4911:Micall2 UTSW 5 139716825 missense probably damaging 1.00
R4996:Micall2 UTSW 5 139710589 missense probably benign 0.31
R5118:Micall2 UTSW 5 139716447 missense probably damaging 1.00
R5155:Micall2 UTSW 5 139710231 missense probably damaging 1.00
R5475:Micall2 UTSW 5 139716469 missense probably damaging 1.00
R5750:Micall2 UTSW 5 139715701 splice site probably null
R5998:Micall2 UTSW 5 139706911 critical splice acceptor site probably null
R6181:Micall2 UTSW 5 139716751 missense probably benign 0.41
R6852:Micall2 UTSW 5 139715793 missense possibly damaging 0.90
R7046:Micall2 UTSW 5 139708944 unclassified probably benign
R7395:Micall2 UTSW 5 139716369 missense possibly damaging 0.78
Z1088:Micall2 UTSW 5 139706894 missense probably damaging 1.00
Z1088:Micall2 UTSW 5 139716295 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCACAGAGAGACAGACCTGG -3'
(R):5'- ACTGTAGTGACTGTCCCCAC -3'

Sequencing Primer
(F):5'- GCAGGTCGCAGCTACATC -3'
(R):5'- AAGGTCCCCACTGTGGTGTC -3'
Posted On2015-04-02