Incidental Mutation 'R3820:Ido2'
ID274858
Institutional Source Beutler Lab
Gene Symbol Ido2
Ensembl Gene ENSMUSG00000031549
Gene Nameindoleamine 2,3-dioxygenase 2
SynonymsIndol1, C230043N17Rik, Ido2
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location24531892-24576333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24533755 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 356 (I356V)
Ref Sequence ENSEMBL: ENSMUSP00000113979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121992]
Predicted Effect probably benign
Transcript: ENSMUST00000121992
AA Change: I356V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000113979
Gene: ENSMUSG00000031549
AA Change: I356V

DomainStartEndE-ValueType
Pfam:IDO 15 399 1.4e-124 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140417
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Along with the enzymes encoded by the INDO (MIM 147435) and TDO2 (MIM 191070) genes, the enzyme encoded by the INDOL1 gene metabolizes tryptophan in the kynurenine pathway (Ball et al., 2007 [PubMed 17499941]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell function and decreased susceptibility to type IV hypersensitivity reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Ido2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0413:Ido2 UTSW 8 24558143 splice site probably null
R1103:Ido2 UTSW 8 24576223 missense probably benign 0.08
R1601:Ido2 UTSW 8 24576189 missense possibly damaging 0.57
R1868:Ido2 UTSW 8 24553760 missense possibly damaging 0.90
R2158:Ido2 UTSW 8 24540636 missense probably damaging 1.00
R2266:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2267:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2268:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2484:Ido2 UTSW 8 24533815 missense probably damaging 1.00
R3151:Ido2 UTSW 8 24533760 missense possibly damaging 0.61
R3735:Ido2 UTSW 8 24535193 missense probably damaging 0.98
R3821:Ido2 UTSW 8 24533755 missense probably benign 0.00
R3822:Ido2 UTSW 8 24533755 missense probably benign 0.00
R4520:Ido2 UTSW 8 24576178 missense probably damaging 0.99
R4824:Ido2 UTSW 8 24533859 missense probably benign 0.12
R4949:Ido2 UTSW 8 24533954 critical splice acceptor site probably null
R5235:Ido2 UTSW 8 24547186 missense probably damaging 0.99
R5580:Ido2 UTSW 8 24550866 missense possibly damaging 0.67
R5961:Ido2 UTSW 8 24533770 missense probably damaging 1.00
R6433:Ido2 UTSW 8 24533923 missense probably damaging 1.00
R7085:Ido2 UTSW 8 24558196 missense probably benign 0.09
R7186:Ido2 UTSW 8 24550810 synonymous probably null
R7248:Ido2 UTSW 8 24540641 nonsense probably null
R7248:Ido2 UTSW 8 24548823 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGATGCAGGATGTGAACCTC -3'
(R):5'- TACATGCCGCCTTCCCATAAG -3'

Sequencing Primer
(F):5'- ATGTGAACCTCTAACGCTGG -3'
(R):5'- CCATAAGGCTTTCCTGGAAGATC -3'
Posted On2015-04-02