Incidental Mutation 'R3820:Aarsd1'
ID274867
Institutional Source Beutler Lab
Gene Symbol Aarsd1
Ensembl Gene ENSMUSG00000075528
Gene Namealanyl-tRNA synthetase domain containing 1
Synonyms2310044P18Rik
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101406839-101417615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101411145 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 332 (I332F)
Ref Sequence ENSEMBL: ENSMUSP00000102880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070395] [ENSMUST00000107257] [ENSMUST00000107259]
Predicted Effect probably damaging
Transcript: ENSMUST00000070395
AA Change: I201F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067912
Gene: ENSMUSG00000075528
AA Change: I201F

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 8 101 1.5e-8 PFAM
tRNA_SAD 196 239 1.43e-6 SMART
low complexity region 276 293 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107257
AA Change: I314F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102878
Gene: ENSMUSG00000097239
AA Change: I314F

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 91 214 1.4e-8 PFAM
tRNA_SAD 309 352 1.43e-6 SMART
low complexity region 389 406 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107259
AA Change: I332F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102880
Gene: ENSMUSG00000097239
AA Change: I332F

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 109 232 3.4e-9 PFAM
tRNA_SAD 327 370 1.43e-6 SMART
low complexity region 407 424 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189049
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Aarsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Aarsd1 APN 11 101417359 nonsense probably null
R0462:Aarsd1 UTSW 11 101414091 missense probably damaging 1.00
R1885:Aarsd1 UTSW 11 101411401 missense probably benign 0.33
R1886:Aarsd1 UTSW 11 101411401 missense probably benign 0.33
R1909:Aarsd1 UTSW 11 101410231 intron probably null
R2382:Aarsd1 UTSW 11 101414078 missense probably damaging 0.99
R3821:Aarsd1 UTSW 11 101411145 missense probably damaging 1.00
R3822:Aarsd1 UTSW 11 101411145 missense probably damaging 1.00
R4034:Aarsd1 UTSW 11 101411332 missense probably damaging 1.00
R4701:Aarsd1 UTSW 11 101411160 missense probably benign 0.00
R5204:Aarsd1 UTSW 11 101406926 missense probably damaging 1.00
R5327:Aarsd1 UTSW 11 101410377 missense probably benign 0.30
R5554:Aarsd1 UTSW 11 101413981 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTTAGGACACAAGGGCAAG -3'
(R):5'- AAAATCAGAGACCGGCTGC -3'

Sequencing Primer
(F):5'- GGCAAGAGAGACCAGACCC -3'
(R):5'- AGTGTTCGAGAGCTGAGCC -3'
Posted On2015-04-02