Incidental Mutation 'R3820:Itgb3'
ID274868
Institutional Source Beutler Lab
Gene Symbol Itgb3
Ensembl Gene ENSMUSG00000020689
Gene Nameintegrin beta 3
SynonymsCD61, platelet glycoprotein IIIa (GP3A)
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.867) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104608000-104670476 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 104633612 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 191 (Y191*)
Ref Sequence ENSEMBL: ENSMUSP00000021028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021028]
Predicted Effect probably null
Transcript: ENSMUST00000021028
AA Change: Y191*
SMART Domains Protein: ENSMUSP00000021028
Gene: ENSMUSG00000020689
AA Change: Y191*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
PSI 29 75 4.43e-5 SMART
INB 37 460 3.16e-276 SMART
VWA 136 395 8.65e-2 SMART
Pfam:EGF_2 511 546 6.8e-7 PFAM
Pfam:EGF_2 553 583 8.1e-7 PFAM
Integrin_B_tail 633 717 1.07e-28 SMART
Integrin_b_cyt 741 787 1.78e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127140
Meta Mutation Damage Score 0.6564 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ITGB3 protein product is the integrin beta chain beta 3. Integrins are integral cell-surface proteins composed of an alpha chain and a beta chain. A given chain may combine with multiple partners resulting in different integrins. Integrin beta 3 is found along with the alpha IIb chain in platelets. Integrins are known to participate in cell adhesion as well as cell-surface mediated signalling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit platelet defects, extended bleeding times, cutaneous and gastrointestinal bleeding, anemia, increased bone mass, hypocalcemia, reduced survival, and placental defects associated with some fetal loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Itgb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Itgb3 APN 11 104633584 missense probably damaging 1.00
IGL01460:Itgb3 APN 11 104662394 nonsense probably null
IGL01615:Itgb3 APN 11 104643965 missense probably damaging 1.00
IGL01669:Itgb3 APN 11 104633390 splice site probably benign
IGL02057:Itgb3 APN 11 104632348 missense probably damaging 1.00
IGL02192:Itgb3 APN 11 104643939 missense probably benign
IGL02604:Itgb3 APN 11 104662443 missense probably damaging 0.99
IGL02708:Itgb3 APN 11 104637829 missense possibly damaging 0.60
IGL02901:Itgb3 APN 11 104637946 missense probably benign 0.18
IGL03288:Itgb3 APN 11 104633467 missense probably damaging 1.00
R0042:Itgb3 UTSW 11 104667140 missense possibly damaging 0.80
R0042:Itgb3 UTSW 11 104667140 missense possibly damaging 0.80
R0123:Itgb3 UTSW 11 104637088 missense probably damaging 1.00
R0125:Itgb3 UTSW 11 104643963 missense probably damaging 1.00
R0637:Itgb3 UTSW 11 104658876 missense probably benign 0.02
R2017:Itgb3 UTSW 11 104637962 missense possibly damaging 0.70
R2045:Itgb3 UTSW 11 104623413 missense probably benign
R2200:Itgb3 UTSW 11 104640986 splice site probably null
R2225:Itgb3 UTSW 11 104665510 missense probably benign 0.00
R2429:Itgb3 UTSW 11 104637088 missense probably damaging 1.00
R4863:Itgb3 UTSW 11 104665520 missense probably damaging 1.00
R5116:Itgb3 UTSW 11 104641077 missense probably benign 0.20
R5301:Itgb3 UTSW 11 104633654 splice site probably null
R5933:Itgb3 UTSW 11 104637979 missense possibly damaging 0.63
R6361:Itgb3 UTSW 11 104665582 missense possibly damaging 0.72
R6436:Itgb3 UTSW 11 104633492 missense probably damaging 0.99
R6452:Itgb3 UTSW 11 104633464 nonsense probably null
R7196:Itgb3 UTSW 11 104633612 nonsense probably null
R7438:Itgb3 UTSW 11 104643577 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCCGTGGACATCTACTACTTG -3'
(R):5'- GCTATGGCTCTTGCATAAAGC -3'

Sequencing Primer
(F):5'- GGACATCTACTACTTGATGGACCTG -3'
(R):5'- TTGATGCTCTTCCCAGAAGAAC -3'
Posted On2015-04-02