Incidental Mutation 'R3820:Adam6b'
ID274871
Institutional Source Beutler Lab
Gene Symbol Adam6b
Ensembl Gene ENSMUSG00000051804
Gene Namea disintegrin and metallopeptidase domain 6B
Synonyms4930523C11Rik
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113489511-113492057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113490364 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 267 (T267I)
Ref Sequence ENSEMBL: ENSMUSP00000065529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063317]
Predicted Effect probably benign
Transcript: ENSMUST00000063317
AA Change: T267I

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065529
Gene: ENSMUSG00000051804
AA Change: T267I

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 30 167 1.1e-16 PFAM
Pfam:Reprolysin 223 407 1.1e-14 PFAM
DISIN 427 502 9.2e-33 SMART
ACR 503 640 2.74e-60 SMART
transmembrane domain 704 726 N/A INTRINSIC
Meta Mutation Damage Score 0.1652 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Adam6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adam6b APN 12 113491393 missense probably damaging 1.00
IGL00800:Adam6b APN 12 113490442 missense probably benign 0.24
IGL01456:Adam6b APN 12 113491463 missense probably benign 0.30
IGL02232:Adam6b APN 12 113491144 missense probably benign 0.06
IGL03039:Adam6b APN 12 113490882 missense probably damaging 1.00
IGL03399:Adam6b APN 12 113491108 missense probably damaging 0.97
IGL03412:Adam6b APN 12 113491770 nonsense probably null
R0234:Adam6b UTSW 12 113490610 missense probably damaging 0.98
R0234:Adam6b UTSW 12 113490610 missense probably damaging 0.98
R0373:Adam6b UTSW 12 113490655 missense probably benign 0.15
R0402:Adam6b UTSW 12 113489995 missense probably damaging 0.96
R0420:Adam6b UTSW 12 113489994 missense probably benign 0.02
R0573:Adam6b UTSW 12 113491658 missense possibly damaging 0.90
R0884:Adam6b UTSW 12 113490995 missense probably damaging 1.00
R1489:Adam6b UTSW 12 113491451 missense probably benign 0.15
R1542:Adam6b UTSW 12 113490939 missense possibly damaging 0.53
R1591:Adam6b UTSW 12 113489832 missense probably benign 0.07
R1596:Adam6b UTSW 12 113491026 missense probably damaging 1.00
R1675:Adam6b UTSW 12 113491044 missense probably benign 0.00
R1699:Adam6b UTSW 12 113490585 missense probably benign 0.02
R1818:Adam6b UTSW 12 113491256 missense probably benign 0.15
R1829:Adam6b UTSW 12 113489925 missense probably damaging 1.00
R1851:Adam6b UTSW 12 113491822 missense probably benign 0.44
R1955:Adam6b UTSW 12 113491816 missense probably benign 0.16
R2040:Adam6b UTSW 12 113490744 missense probably benign 0.34
R4112:Adam6b UTSW 12 113489636 missense possibly damaging 0.85
R4434:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4435:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4437:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4438:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4509:Adam6b UTSW 12 113490352 missense probably benign 0.02
R5034:Adam6b UTSW 12 113490927 missense probably damaging 1.00
R5316:Adam6b UTSW 12 113491393 missense probably damaging 1.00
R5330:Adam6b UTSW 12 113490580 missense possibly damaging 0.45
R5331:Adam6b UTSW 12 113490580 missense possibly damaging 0.45
R5604:Adam6b UTSW 12 113490800 nonsense probably null
R5698:Adam6b UTSW 12 113491463 missense probably benign 0.30
R5877:Adam6b UTSW 12 113490202 missense probably damaging 1.00
R6235:Adam6b UTSW 12 113491710 missense probably benign
R6254:Adam6b UTSW 12 113489570 missense probably damaging 0.99
R6371:Adam6b UTSW 12 113490274 missense probably damaging 0.99
R6617:Adam6b UTSW 12 113490532 missense possibly damaging 0.78
R6768:Adam6b UTSW 12 113490243 missense probably benign 0.01
R7002:Adam6b UTSW 12 113489707 nonsense probably null
R7003:Adam6b UTSW 12 113490042 nonsense probably null
R7049:Adam6b UTSW 12 113490502 missense probably damaging 0.99
R7313:Adam6b UTSW 12 113491134 missense probably benign 0.00
R7372:Adam6b UTSW 12 113490164 missense probably benign 0.24
T0722:Adam6b UTSW 12 113489577 missense possibly damaging 0.91
T0722:Adam6b UTSW 12 113491268 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGGAATATGCAGATGGAGCTC -3'
(R):5'- AGGGCTAAGGAAGAACATATACTCC -3'

Sequencing Primer
(F):5'- TGGAGCTCCCAGAATATCTAGTAAG -3'
(R):5'- GAACATATACTCCTCTCAGCTGG -3'
Posted On2015-04-02