Incidental Mutation 'R3820:Zfp729a'
ID274876
Institutional Source Beutler Lab
Gene Symbol Zfp729a
Ensembl Gene ENSMUSG00000021510
Gene Namezinc finger protein 729a
SynonymsA530054K11Rik
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R3820 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67612763-67637791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67621319 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 264 (C264S)
Ref Sequence ENSEMBL: ENSMUSP00000012314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012314] [ENSMUST00000224814] [ENSMUST00000225627]
Predicted Effect probably damaging
Transcript: ENSMUST00000012314
AA Change: C264S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000012314
Gene: ENSMUSG00000021510
AA Change: C264S

DomainStartEndE-ValueType
KRAB 15 75 6.23e-34 SMART
ZnF_C2H2 91 111 1.91e1 SMART
ZnF_C2H2 147 169 8.34e-3 SMART
PHD 148 209 9.1e0 SMART
ZnF_C2H2 175 197 3.21e-4 SMART
ZnF_C2H2 203 225 6.78e-3 SMART
ZnF_C2H2 231 253 4.47e-3 SMART
PHD 232 293 1.11e1 SMART
RING 233 292 9.27e0 SMART
ZnF_C2H2 259 281 6.67e-2 SMART
ZnF_C2H2 287 309 1.12e-3 SMART
ZnF_C2H2 315 337 3.83e-2 SMART
PHD 316 377 1.35e1 SMART
ZnF_C2H2 343 365 2.57e-3 SMART
ZnF_C2H2 371 393 1.98e-4 SMART
Pfam:zf-C2HC_2 402 422 7.7e-4 PFAM
ZnF_C2H2 427 449 1.67e-2 SMART
ZnF_C2H2 455 477 1.38e-3 SMART
PHD 456 517 5.33e0 SMART
RING 457 516 9.02e0 SMART
ZnF_C2H2 483 505 3.89e-3 SMART
ZnF_C2H2 511 533 7.49e-5 SMART
ZnF_C2H2 539 561 5.5e-3 SMART
PHD 540 601 1.46e1 SMART
ZnF_C2H2 567 589 3.58e-2 SMART
ZnF_C2H2 595 617 8.34e-3 SMART
ZnF_C2H2 651 673 4.11e-2 SMART
PHD 652 713 4.64e0 SMART
RING 653 712 6.37e0 SMART
ZnF_C2H2 679 701 2.4e-3 SMART
ZnF_C2H2 707 729 1.03e-2 SMART
ZnF_C2H2 735 757 1.47e-3 SMART
PHD 736 797 5.44e0 SMART
RING 737 796 5.88e0 SMART
ZnF_C2H2 763 785 6.67e-2 SMART
ZnF_C2H2 791 813 2.36e-2 SMART
ZnF_C2H2 819 841 6.32e-3 SMART
ZnF_C2H2 847 869 1.26e-2 SMART
ZnF_C2H2 875 897 6.78e-3 SMART
PHD 876 937 4.55e0 SMART
ZnF_C2H2 903 925 9.58e-3 SMART
ZnF_C2H2 931 953 9.08e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224548
Predicted Effect probably benign
Transcript: ENSMUST00000224814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225608
Predicted Effect probably benign
Transcript: ENSMUST00000225627
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Zfp729a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Zfp729a APN 13 67619321 missense probably benign 0.01
IGL01956:Zfp729a APN 13 67621686 missense probably damaging 1.00
IGL02852:Zfp729a APN 13 67619951 missense possibly damaging 0.69
IGL03130:Zfp729a APN 13 67619642 intron probably null
adalet UTSW 13 67619507 missense probably benign 0.00
R0329:Zfp729a UTSW 13 67620354 missense probably damaging 1.00
R0330:Zfp729a UTSW 13 67620354 missense probably damaging 1.00
R0383:Zfp729a UTSW 13 67621673 missense possibly damaging 0.83
R0545:Zfp729a UTSW 13 67620226 missense probably benign 0.09
R1013:Zfp729a UTSW 13 67619507 missense probably benign 0.00
R1079:Zfp729a UTSW 13 67619675 missense possibly damaging 0.71
R1255:Zfp729a UTSW 13 67621846 missense probably benign 0.03
R1525:Zfp729a UTSW 13 67619321 missense probably benign 0.01
R1768:Zfp729a UTSW 13 67619251 missense probably benign 0.00
R1926:Zfp729a UTSW 13 67619557 missense probably benign 0.29
R2043:Zfp729a UTSW 13 67621172 missense probably damaging 1.00
R2118:Zfp729a UTSW 13 67621494 intron probably null
R3830:Zfp729a UTSW 13 67619878 missense probably damaging 1.00
R3926:Zfp729a UTSW 13 67620191 nonsense probably null
R4134:Zfp729a UTSW 13 67619806 missense probably damaging 1.00
R4135:Zfp729a UTSW 13 67619806 missense probably damaging 1.00
R4670:Zfp729a UTSW 13 67621415 nonsense probably null
R4793:Zfp729a UTSW 13 67620427 missense probably damaging 1.00
R5009:Zfp729a UTSW 13 67620246 missense probably benign 0.01
R5125:Zfp729a UTSW 13 67637645 critical splice donor site probably null
R5178:Zfp729a UTSW 13 67637645 critical splice donor site probably null
R5438:Zfp729a UTSW 13 67619586 missense possibly damaging 0.94
R6540:Zfp729a UTSW 13 67619648 missense possibly damaging 0.81
R6731:Zfp729a UTSW 13 67620146 missense probably benign 0.09
R6987:Zfp729a UTSW 13 67619939 nonsense probably null
R7001:Zfp729a UTSW 13 67620349 missense probably benign 0.31
X0010:Zfp729a UTSW 13 67621782 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACAGAGAACGAAAAGCCT -3'
(R):5'- AGGTCCTTCCATAGTCCATCATTA -3'

Sequencing Primer
(F):5'- TCTTGAGGGATAATCGAAAGCCTTG -3'
(R):5'- GAGTTCATACAGGAGAGAATCTCTAC -3'
Posted On2015-04-02