Incidental Mutation 'R3820:Arhgap22'
ID274878
Institutional Source Beutler Lab
Gene Symbol Arhgap22
Ensembl Gene ENSMUSG00000063506
Gene NameRho GTPase activating protein 22
SynonymsRHOGAP2, B230341L19Rik
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location33214026-33369934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33367421 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 455 (E455K)
Ref Sequence ENSEMBL: ENSMUSP00000107586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111955] [ENSMUST00000111956] [ENSMUST00000140711]
Predicted Effect probably benign
Transcript: ENSMUST00000111955
AA Change: E455K

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107586
Gene: ENSMUSG00000063506
AA Change: E455K

DomainStartEndE-ValueType
Blast:PH 18 57 6e-18 BLAST
RhoGAP 80 187 3.03e-7 SMART
low complexity region 307 318 N/A INTRINSIC
low complexity region 340 381 N/A INTRINSIC
low complexity region 388 398 N/A INTRINSIC
coiled coil region 447 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111956
AA Change: E620K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000107587
Gene: ENSMUSG00000063506
AA Change: E620K

DomainStartEndE-ValueType
PH 44 153 1.03e-24 SMART
RhoGAP 176 352 1.96e-65 SMART
low complexity region 472 483 N/A INTRINSIC
low complexity region 505 546 N/A INTRINSIC
low complexity region 553 563 N/A INTRINSIC
coiled coil region 612 691 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140166
Predicted Effect probably benign
Transcript: ENSMUST00000140711
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTPase activating protein family which activates a GTPase belonging to the RAS superfamily of small GTP-binding proteins. The encoded protein is insulin-responsive, is dependent on the kinase Akt and requires the Akt-dependent 14-3-3 binding protein which binds sequentially to two serine residues. The result of these interactions is regulation of cell motility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Arhgap22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Arhgap22 APN 14 33359273 missense probably damaging 1.00
IGL02707:Arhgap22 APN 14 33363272 splice site probably benign
R0329:Arhgap22 UTSW 14 33369417 missense possibly damaging 0.55
R0330:Arhgap22 UTSW 14 33369417 missense possibly damaging 0.55
R0335:Arhgap22 UTSW 14 33359108 splice site probably benign
R0625:Arhgap22 UTSW 14 33366714 missense probably benign 0.01
R0961:Arhgap22 UTSW 14 33367113 missense probably damaging 0.98
R1167:Arhgap22 UTSW 14 33343307 unclassified probably null
R1991:Arhgap22 UTSW 14 33366959 missense probably damaging 0.98
R4377:Arhgap22 UTSW 14 33369510 missense probably damaging 0.99
R4670:Arhgap22 UTSW 14 33362543 missense probably damaging 1.00
R4671:Arhgap22 UTSW 14 33362543 missense probably damaging 1.00
R5177:Arhgap22 UTSW 14 33366693 missense probably benign 0.09
R5910:Arhgap22 UTSW 14 33366615 missense probably damaging 0.98
R7297:Arhgap22 UTSW 14 33271933 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAACTCTTCTGCCTGCAG -3'
(R):5'- AAACTGACATTCTCCCTTGTGG -3'

Sequencing Primer
(F):5'- TGCAGCTCCTTACACACCGAG -3'
(R):5'- TTGTGGAGGCCTGCCAG -3'
Posted On2015-04-02