Incidental Mutation 'R3820:Abcd2'
ID274881
Institutional Source Beutler Lab
Gene Symbol Abcd2
Ensembl Gene ENSMUSG00000055782
Gene NameATP-binding cassette, sub-family D (ALD), member 2
SynonymsABC39, adrenoleukodystrophy related, ALDL1, ALDR
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location91145871-91191799 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91174705 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 512 (G512D)
Ref Sequence ENSEMBL: ENSMUSP00000068940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069511]
Predicted Effect probably damaging
Transcript: ENSMUST00000069511
AA Change: G512D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068940
Gene: ENSMUSG00000055782
AA Change: G512D

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
Pfam:ABC_membrane_2 78 365 1.9e-110 PFAM
AAA 504 690 2.79e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229909
Meta Mutation Damage Score 0.456 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown; however this protein is speculated to function as a dimerization partner of Abcd1 and/or other peroxisomal ABC transporters. Mutations in the human gene have been observed in patients with adrenoleukodystrophy, a severe demyelinating disease. This gene has been identified as a candidate for a modifier gene, accounting for the extreme variation among adrenoleukodystrophy phenotypes. This gene is also a candidate for a complement group of Zellweger syndrome, a genetically heterogeneous disorder of peroxisomal biogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene exhibit a late-onset cerebellar and sensory ataxia, loss of Purkinje cells, dorsal root ganglia cell degeneration, axonal degeneration in the spinal cord, and an accumulation of very long chain fatty acids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Abcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Abcd2 APN 15 91149213 splice site probably benign
IGL01515:Abcd2 APN 15 91163086 missense probably damaging 1.00
IGL01733:Abcd2 APN 15 91191614 utr 5 prime probably benign
IGL02084:Abcd2 APN 15 91178327 critical splice acceptor site probably null
IGL02408:Abcd2 APN 15 91178241 missense possibly damaging 0.95
IGL02568:Abcd2 APN 15 91148981 utr 3 prime probably benign
IGL02942:Abcd2 APN 15 91149175 missense probably damaging 0.99
IGL03281:Abcd2 APN 15 91151673 missense probably damaging 1.00
R0463:Abcd2 UTSW 15 91159124 missense probably benign 0.01
R1226:Abcd2 UTSW 15 91191043 missense probably benign
R1510:Abcd2 UTSW 15 91188978 missense probably damaging 1.00
R1581:Abcd2 UTSW 15 91179144 missense probably benign
R1802:Abcd2 UTSW 15 91163102 missense probably benign
R1918:Abcd2 UTSW 15 91191481 missense probably benign
R2184:Abcd2 UTSW 15 91191439 missense probably benign
R3821:Abcd2 UTSW 15 91174705 missense probably damaging 0.99
R4486:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4487:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4489:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4706:Abcd2 UTSW 15 91159182 missense probably benign 0.03
R4707:Abcd2 UTSW 15 91159182 missense probably benign 0.03
R4727:Abcd2 UTSW 15 91178286 missense probably benign 0.33
R4872:Abcd2 UTSW 15 91191311 missense probably benign
R4971:Abcd2 UTSW 15 91163110 missense probably benign 0.06
R5492:Abcd2 UTSW 15 91188973 missense probably benign
R6049:Abcd2 UTSW 15 91178236 missense probably benign 0.00
R6143:Abcd2 UTSW 15 91190947 missense possibly damaging 0.95
R6177:Abcd2 UTSW 15 91190693 missense probably damaging 0.99
R6566:Abcd2 UTSW 15 91191118 missense probably damaging 1.00
R7108:Abcd2 UTSW 15 91191274 missense probably benign 0.43
R7208:Abcd2 UTSW 15 91190682 nonsense probably null
R7212:Abcd2 UTSW 15 91159123 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AGCATAACCCGAAGAGCCTG -3'
(R):5'- CTCAGTTGAAGTGTTGTAGAGTCAG -3'

Sequencing Primer
(F):5'- CCCGAAGAGCCTGAGAAACG -3'
(R):5'- GCTACTTTTAGCTTCAGAGAATAGTC -3'
Posted On2015-04-02