Incidental Mutation 'R3821:Hscb'
ID274909
Institutional Source Beutler Lab
Gene Symbol Hscb
Ensembl Gene ENSMUSG00000043510
Gene NameHscB iron-sulfur cluster co-chaperone
Synonyms
MMRRC Submission 040883-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R3821 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110829070-110839777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110836328 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 52 (D52E)
Ref Sequence ENSEMBL: ENSMUSP00000120926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056937] [ENSMUST00000066160] [ENSMUST00000145318] [ENSMUST00000198373] [ENSMUST00000199937] [ENSMUST00000200172]
Predicted Effect probably damaging
Transcript: ENSMUST00000056937
AA Change: D103E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062811
Gene: ENSMUSG00000043510
AA Change: D103E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DnaJ 70 135 6.53e-3 SMART
Pfam:HSCB_C 156 228 9.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066160
SMART Domains Protein: ENSMUSP00000066679
Gene: ENSMUSG00000029521

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 5.14e-3 SMART
S_TKc 224 490 7.35e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122921
Predicted Effect probably benign
Transcript: ENSMUST00000144850
Predicted Effect probably damaging
Transcript: ENSMUST00000145318
AA Change: D52E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120926
Gene: ENSMUSG00000043510
AA Change: D52E

DomainStartEndE-ValueType
DnaJ 19 84 6.53e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198373
Predicted Effect probably benign
Transcript: ENSMUST00000199937
SMART Domains Protein: ENSMUSP00000143558
Gene: ENSMUSG00000029521

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 2.6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200172
Meta Mutation Damage Score 0.444 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DnaJ-type co-chaperone and member of the heat shock cognate B (HscB) family of proteins. The encoded protein plays a role in the synthesis of iron-sulfur clusters, protein cofactors that are involved in the redox reactions of mitochondrial electron transport and other processes. Cells in which this gene is knocked down exhibit reduced activity of iron-sulfur cluster-dependent enzymes including succinate dehydrogenase and aconitase. The encoded protein may stimulate the ATPase activity of the mitochondrial stress-70 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Adamtsl3 G T 7: 82,606,479 probably benign Het
Alox8 T A 11: 69,186,482 I481F probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Arpin G A 7: 79,929,660 R72C probably damaging Het
C6 A G 15: 4,789,584 E466G probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Clgn A G 8: 83,420,477 I353V probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cramp1l G A 17: 24,974,782 T908I probably damaging Het
Dnah9 C A 11: 65,851,003 probably null Het
Ehd3 A T 17: 73,827,395 I250F probably benign Het
Eml2 T C 7: 19,202,986 V555A possibly damaging Het
Erbb4 A G 1: 68,305,913 S550P probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Frem2 A T 3: 53,652,415 L1557Q probably damaging Het
Gbf1 T C 19: 46,264,807 I506T probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Hoxc9 A G 15: 102,982,164 K171R probably benign Het
Htr1b A T 9: 81,632,434 I40N probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Irs1 T C 1: 82,290,049 T149A probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Itpr2 A T 6: 146,417,726 H244Q probably damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdm3a A T 6: 71,611,677 D449E probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lhfpl4 A G 6: 113,194,108 V39A probably benign Het
Marf1 A T 16: 14,142,554 L542Q probably damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrpl19 C A 6: 81,962,006 E272* probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Olfr435 A G 6: 43,201,670 T9A probably benign Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Ptprb G T 10: 116,350,074 R1678L probably benign Het
Ptprg A T 14: 12,226,375 I1323L probably benign Het
Rab40b T A 11: 121,358,048 N127I probably damaging Het
Scn10a A G 9: 119,638,633 C814R probably benign Het
Sdhb C T 4: 140,979,088 R279* probably null Het
Shroom4 C T X: 6,624,222 Q1165* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Slc20a2 A G 8: 22,538,902 I130V probably benign Het
Slitrk3 T C 3: 73,049,216 Y741C possibly damaging Het
Tas1r1 G T 4: 152,034,681 L144I probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmbim1 A G 1: 74,293,930 V92A probably damaging Het
Tmem131 T A 1: 36,808,396 H1207L probably damaging Het
Tmem209 G T 6: 30,505,960 P116T probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Tnfsf8 A G 4: 63,860,890 V57A probably benign Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpc6 A T 9: 8,610,278 D249V probably damaging Het
Ubr3 G A 2: 69,993,813 probably null Het
Ufc1 A G 1: 171,289,599 probably benign Het
Unc5cl T C 17: 48,459,973 L125P possibly damaging Het
Usb1 G A 8: 95,333,433 S57N probably benign Het
Wdfy1 A G 1: 79,706,300 S373P probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in Hscb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Hscb APN 5 110830954 missense probably benign 0.00
IGL02170:Hscb APN 5 110839626 missense probably damaging 1.00
potsticker UTSW 5 110834792 missense probably damaging 1.00
PIT4520001:Hscb UTSW 5 110835985 missense probably damaging 1.00
R0277:Hscb UTSW 5 110834690 missense possibly damaging 0.91
R0323:Hscb UTSW 5 110834690 missense possibly damaging 0.91
R1873:Hscb UTSW 5 110830957 missense probably benign
R1940:Hscb UTSW 5 110836060 missense probably benign
R5294:Hscb UTSW 5 110834792 missense probably damaging 1.00
R5883:Hscb UTSW 5 110839578 missense probably benign
R6337:Hscb UTSW 5 110839494 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCGTTATCTGGGAAGCCAG -3'
(R):5'- CCTTCATTGCAGCTACCAGG -3'

Sequencing Primer
(F):5'- TCTGGGAAGCCAGATAAAAGCTG -3'
(R):5'- TGCAGCTACCAGGTCTTAAAAATAAC -3'
Posted On2015-04-02