Incidental Mutation 'R3807:Npr1'
ID274962
Institutional Source Beutler Lab
Gene Symbol Npr1
Ensembl Gene ENSMUSG00000027931
Gene Namenatriuretic peptide receptor 1
SynonymsNPRA, guanylyl cyclase-A, GC-A, NPR-A
MMRRC Submission 040764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R3807 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location90450591-90465866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90458726 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 586 (V586E)
Ref Sequence ENSEMBL: ENSMUSP00000029540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029540]
Predicted Effect probably damaging
Transcript: ENSMUST00000029540
AA Change: V586E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029540
Gene: ENSMUSG00000027931
AA Change: V586E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 50 410 4.7e-54 PFAM
low complexity region 468 488 N/A INTRINSIC
Pfam:Pkinase_Tyr 538 797 1.2e-39 PFAM
Pfam:Pkinase 543 796 8.7e-31 PFAM
CYCc 836 1030 5.04e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124760
SMART Domains Protein: ENSMUSP00000118023
Gene: ENSMUSG00000027931

DomainStartEndE-ValueType
PDB:3A3K|B 2 20 1e-8 PDB
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146991
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylyl cyclases, catalyzing the production of cGMP from GTP, are classified as soluble and membrane forms (Garbers and Lowe, 1994 [PubMed 7982997]). The membrane guanylyl cyclases, often termed guanylyl cyclases A through F, form a family of cell-surface receptors with a similar topographic structure: an extracellular ligand-binding domain, a single membrane-spanning domain, and an intracellular region that contains a protein kinase-like domain and a cyclase catalytic domain. GC-A and GC-B function as receptors for natriuretic peptides; they are also referred to as atrial natriuretic peptide receptor A (NPR1) and type B (NPR2; MIM 108961). Also see NPR3 (MIM 108962), which encodes a protein with only the ligand-binding transmembrane and 37-amino acid cytoplasmic domains. NPR1 is a membrane-bound guanylate cyclase that serves as the receptor for both atrial and brain natriuretic peptides (ANP (MIM 108780) and BNP (MIM 600295), respectively).[supplied by OMIM, May 2009]
PHENOTYPE: Homozygous inactivation of this gene can lead to hypertension, cardiac hypertrophy, lethal vascular events, congestive heart failure in response to volume overload, reduced serum testosterone levels, altered steroidogenesis, and reduced myocardial PMN infiltration and infarct size after I/R injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Other mutations in Npr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Npr1 APN 3 90458362 missense probably damaging 1.00
IGL01432:Npr1 APN 3 90463236 missense possibly damaging 0.85
IGL02106:Npr1 APN 3 90464858 missense probably benign 0.12
IGL03310:Npr1 APN 3 90455991 missense probably benign 0.30
PIT4581001:Npr1 UTSW 3 90462257 missense probably damaging 1.00
R0010:Npr1 UTSW 3 90454832 missense probably damaging 1.00
R0137:Npr1 UTSW 3 90455937 missense probably damaging 1.00
R0384:Npr1 UTSW 3 90465167 missense probably damaging 0.98
R0656:Npr1 UTSW 3 90461369 missense probably benign
R0941:Npr1 UTSW 3 90461409 missense probably benign
R0961:Npr1 UTSW 3 90458721 missense possibly damaging 0.91
R1172:Npr1 UTSW 3 90461382 missense probably benign 0.01
R1747:Npr1 UTSW 3 90458669 missense possibly damaging 0.88
R1763:Npr1 UTSW 3 90459337 missense probably damaging 0.98
R1900:Npr1 UTSW 3 90462188 missense probably damaging 0.98
R4017:Npr1 UTSW 3 90456232 missense probably damaging 1.00
R4437:Npr1 UTSW 3 90456286 missense probably damaging 1.00
R4900:Npr1 UTSW 3 90455965 missense possibly damaging 0.77
R5265:Npr1 UTSW 3 90457002 missense probably benign 0.29
R5343:Npr1 UTSW 3 90458208 missense possibly damaging 0.94
R5590:Npr1 UTSW 3 90454842 missense probably damaging 0.99
R5868:Npr1 UTSW 3 90459493 intron probably benign
R6782:Npr1 UTSW 3 90456253 missense probably benign 0.18
R6828:Npr1 UTSW 3 90464813 missense probably benign
R6903:Npr1 UTSW 3 90455145 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ACTCCCATTTACAGAGAGGCC -3'
(R):5'- GTCATGAGAGATCACTGGGTCC -3'

Sequencing Primer
(F):5'- AGAGGAAGCTTATCTGGGCTC -3'
(R):5'- TCCTCCAGGGTCCAGACG -3'
Posted On2015-04-02