Incidental Mutation 'R3807:Nfe2l3'
ID274966
Institutional Source Beutler Lab
Gene Symbol Nfe2l3
Ensembl Gene ENSMUSG00000029832
Gene Namenuclear factor, erythroid derived 2, like 3
SynonymsNrf3
MMRRC Submission 040764-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3807 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location51432670-51458768 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 51457377 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 306 (R306*)
Ref Sequence ENSEMBL: ENSMUSP00000005103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005103] [ENSMUST00000069949] [ENSMUST00000090002] [ENSMUST00000160133] [ENSMUST00000203954] [ENSMUST00000204158]
Predicted Effect probably null
Transcript: ENSMUST00000005103
AA Change: R306*
SMART Domains Protein: ENSMUSP00000005103
Gene: ENSMUSG00000029832
AA Change: R306*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 145 155 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
BRLZ 539 603 3.68e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069949
SMART Domains Protein: ENSMUSP00000067491
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 5.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090002
SMART Domains Protein: ENSMUSP00000087453
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160133
SMART Domains Protein: ENSMUSP00000124920
Gene: ENSMUSG00000029832

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 145 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203954
SMART Domains Protein: ENSMUSP00000145028
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 22 94 1.51e-23 SMART
RRM 113 185 7.64e-20 SMART
low complexity region 198 307 N/A INTRINSIC
low complexity region 322 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204158
SMART Domains Protein: ENSMUSP00000145383
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 9.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204885
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cap 'n' collar basic-region leucine zipper family of transcription factors. The encoded protein heterodimerizes with small musculoaponeurotic fibrosarcoma factors to bind antioxidant response elements in target genes. This protein is a membrane bound glycoprotein that is targeted to the endoplasmic reticulum and the nuclear envelope. Pseudogenes of this gene are found on chromosomes 16, 17, and 18. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Other mutations in Nfe2l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02705:Nfe2l3 APN 6 51433118 missense probably damaging 0.96
IGL02803:Nfe2l3 APN 6 51457311 missense possibly damaging 0.50
R0277:Nfe2l3 UTSW 6 51457468 missense probably benign 0.30
R0693:Nfe2l3 UTSW 6 51433054 missense possibly damaging 0.94
R1397:Nfe2l3 UTSW 6 51433294 missense probably benign 0.00
R1455:Nfe2l3 UTSW 6 51457764 missense possibly damaging 0.91
R1541:Nfe2l3 UTSW 6 51457605 missense probably damaging 0.98
R1753:Nfe2l3 UTSW 6 51433412 missense probably null 0.96
R1946:Nfe2l3 UTSW 6 51457315 missense probably damaging 1.00
R2034:Nfe2l3 UTSW 6 51458370 missense possibly damaging 0.50
R3932:Nfe2l3 UTSW 6 51456615 missense possibly damaging 0.94
R4271:Nfe2l3 UTSW 6 51456634 missense probably damaging 0.99
R4604:Nfe2l3 UTSW 6 51451012 missense probably damaging 0.99
R4816:Nfe2l3 UTSW 6 51456624 missense probably damaging 0.99
R5765:Nfe2l3 UTSW 6 51457246 missense probably damaging 1.00
R5893:Nfe2l3 UTSW 6 51457852 missense probably damaging 1.00
R7378:Nfe2l3 UTSW 6 51457296 nonsense probably null
R7490:Nfe2l3 UTSW 6 51457544 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CGTAAGACTATTAGCAATGGAACTG -3'
(R):5'- ACCTGTGGCCAATGACATTAG -3'

Sequencing Primer
(F):5'- GCAATGGAACTGTTTGAAATAGTG -3'
(R):5'- GTGGCCAATGACATTAGGTTTATTCC -3'
Posted On2015-04-02