Incidental Mutation 'R3807:Vmn1r70'
ID274968
Institutional Source Beutler Lab
Gene Symbol Vmn1r70
Ensembl Gene ENSMUSG00000045340
Gene Namevomeronasal 1 receptor 70
SynonymsV1rl1
MMRRC Submission 040764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3807 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location10631532-10636530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10633788 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 68 (T68A)
Ref Sequence ENSEMBL: ENSMUSP00000154041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055847] [ENSMUST00000226255] [ENSMUST00000228090]
Predicted Effect probably benign
Transcript: ENSMUST00000055847
AA Change: T68A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000054445
Gene: ENSMUSG00000045340
AA Change: T68A

DomainStartEndE-ValueType
Pfam:TAS2R 1 292 2.6e-9 PFAM
Pfam:V1R 33 295 3.1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226182
Predicted Effect probably benign
Transcript: ENSMUST00000226255
AA Change: T68A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000228090
AA Change: T49A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Other mutations in Vmn1r70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03092:Vmn1r70 APN 7 10634259 missense probably benign 0.23
IGL03250:Vmn1r70 APN 7 10634281 missense probably damaging 1.00
R0375:Vmn1r70 UTSW 7 10634060 missense probably damaging 1.00
R0482:Vmn1r70 UTSW 7 10634277 missense probably damaging 1.00
R0497:Vmn1r70 UTSW 7 10634026 missense probably benign 0.19
R1964:Vmn1r70 UTSW 7 10633810 missense possibly damaging 0.88
R2067:Vmn1r70 UTSW 7 10634337 missense possibly damaging 0.61
R4573:Vmn1r70 UTSW 7 10633629 splice site probably null
R5070:Vmn1r70 UTSW 7 10634398 missense probably benign 0.04
R5442:Vmn1r70 UTSW 7 10633950 missense possibly damaging 0.69
R5558:Vmn1r70 UTSW 7 10634475 missense probably benign 0.01
R6036:Vmn1r70 UTSW 7 10633903 missense probably damaging 1.00
R6036:Vmn1r70 UTSW 7 10633903 missense probably damaging 1.00
R6189:Vmn1r70 UTSW 7 10633671 missense probably benign 0.04
R6976:Vmn1r70 UTSW 7 10634044 missense probably benign 0.02
X0020:Vmn1r70 UTSW 7 10633590 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGACCTAACCTTGGGGATC -3'
(R):5'- TTACAAGTAGGCACAGGGACC -3'

Sequencing Primer
(F):5'- GTCAGGACAAGGCCTATA -3'
(R):5'- AGAACTAATGATTTTGGGAGCTCTG -3'
Posted On2015-04-02