Incidental Mutation 'R3807:Dmbt1'
ID 274975
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Name deleted in malignant brain tumors 1
Synonyms Crpd, gp300, hensin, CRP-[b], MUCLIN, ebnerin, CRP-[a], vomeroglandin
MMRRC Submission 040764-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R3807 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 130633787-130723357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 130713819 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1455 (M1455K)
Ref Sequence ENSEMBL: ENSMUSP00000148657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000084509
AA Change: M1618K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: M1618K

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208311
AA Change: M1629K
Predicted Effect possibly damaging
Transcript: ENSMUST00000213064
AA Change: M1455K

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 112,717,002 (GRCm39) W2R probably damaging Het
Arhgap42 A G 9: 9,008,034 (GRCm39) I563T probably damaging Het
Armcx1 T C X: 133,622,014 (GRCm39) V372A probably damaging Het
Bicd1 T A 6: 149,420,489 (GRCm39) L780M probably damaging Het
Bpifb1 C A 2: 154,055,922 (GRCm39) N329K probably benign Het
Ccdc113 A T 8: 96,269,281 (GRCm39) N193I probably damaging Het
Cebpz A T 17: 79,242,847 (GRCm39) L269Q probably damaging Het
Cttn C T 7: 143,999,588 (GRCm39) V290M probably damaging Het
Ctu1 T C 7: 43,326,097 (GRCm39) L252P probably damaging Het
Eme1 A G 11: 94,541,418 (GRCm39) W135R probably damaging Het
Entpd7 T G 19: 43,713,979 (GRCm39) probably null Het
Eri2 A T 7: 119,385,231 (GRCm39) C423* probably null Het
Erich1 T C 8: 14,083,695 (GRCm39) N125S probably benign Het
Fam149a T A 8: 45,834,647 (GRCm39) T51S possibly damaging Het
Fer1l4 C T 2: 155,887,603 (GRCm39) G531D probably damaging Het
Frem2 A T 3: 53,560,870 (GRCm39) D1212E probably benign Het
Garin3 G A 11: 46,295,780 (GRCm39) A51T possibly damaging Het
Get4 G T 5: 139,238,286 (GRCm39) V23F probably damaging Het
Gm11595 C T 11: 99,663,380 (GRCm39) R100H unknown Het
Gria1 T C 11: 57,201,504 (GRCm39) W712R probably damaging Het
Herc2 A G 7: 55,857,557 (GRCm39) N4047D probably damaging Het
Hoxc9 A G 15: 102,890,116 (GRCm39) Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,066,661 (GRCm39) probably null Het
Lrrc56 A G 7: 140,789,298 (GRCm39) T393A probably benign Het
Lrrc7 T C 3: 157,891,130 (GRCm39) I346V probably benign Het
Med14 T C X: 12,553,416 (GRCm39) Y463C probably damaging Het
Nalcn T A 14: 123,515,599 (GRCm39) D1734V probably damaging Het
Nfe2l3 A T 6: 51,434,357 (GRCm39) R306* probably null Het
Nolc1 CAG CAGAAG 19: 46,069,798 (GRCm39) probably benign Het
Nolc1 CAG CAGAAG 19: 46,069,810 (GRCm39) probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,069,791 (GRCm39) probably benign Het
Npr1 A T 3: 90,366,033 (GRCm39) V586E probably damaging Het
Or2d2b A G 7: 106,705,670 (GRCm39) S133P probably benign Het
Or5h24 A C 16: 58,919,206 (GRCm39) *50G probably null Het
Pcdhb4 T C 18: 37,442,367 (GRCm39) F559S probably damaging Het
Psmd12 T G 11: 107,386,591 (GRCm39) D387E probably benign Het
Psme4 T A 11: 30,806,027 (GRCm39) probably null Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rgs11 A T 17: 26,422,474 (GRCm39) I69F probably damaging Het
Ryr1 C T 7: 28,719,577 (GRCm39) A4277T probably damaging Het
Setbp1 C T 18: 78,826,537 (GRCm39) V1359I probably benign Het
Sis A T 3: 72,832,929 (GRCm39) V956E probably benign Het
Slc35f3 T A 8: 127,115,978 (GRCm39) W302R probably damaging Het
Syt16 A G 12: 74,276,172 (GRCm39) E212G possibly damaging Het
Tdp2 C A 13: 25,015,776 (GRCm39) S21* probably null Het
Tfrc A T 16: 32,435,644 (GRCm39) N173I possibly damaging Het
Tmem132b A T 5: 125,864,644 (GRCm39) I917F probably damaging Het
Vbp1 T C X: 74,566,948 (GRCm39) V122A probably damaging Het
Vmn1r225 G A 17: 20,723,114 (GRCm39) W185* probably null Het
Vmn1r70 A G 7: 10,367,715 (GRCm39) T68A probably benign Het
Zfp518a A G 19: 40,903,241 (GRCm39) K1057E possibly damaging Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 130,681,270 (GRCm39) intron probably benign
IGL00161:Dmbt1 APN 7 130,711,357 (GRCm39) missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 130,701,020 (GRCm39) missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 130,684,230 (GRCm39) missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 130,699,337 (GRCm39) missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 130,659,888 (GRCm39) missense probably benign 0.26
IGL01072:Dmbt1 APN 7 130,687,098 (GRCm39) splice site probably benign
IGL01317:Dmbt1 APN 7 130,642,921 (GRCm39) missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 130,690,497 (GRCm39) missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 130,705,409 (GRCm39) missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 130,718,457 (GRCm39) missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 130,682,915 (GRCm39) missense probably benign 0.14
IGL01890:Dmbt1 APN 7 130,676,149 (GRCm39) intron probably benign
IGL02160:Dmbt1 APN 7 130,684,418 (GRCm39) missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 130,694,986 (GRCm39) splice site probably benign
IGL02197:Dmbt1 APN 7 130,687,152 (GRCm39) splice site probably benign
IGL02332:Dmbt1 APN 7 130,668,343 (GRCm39) intron probably benign
IGL02427:Dmbt1 APN 7 130,689,815 (GRCm39) splice site probably null
IGL02726:Dmbt1 APN 7 130,676,140 (GRCm39) intron probably benign
IGL02967:Dmbt1 APN 7 130,672,919 (GRCm39) missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 130,684,409 (GRCm39) missense probably benign 0.05
IGL03089:Dmbt1 APN 7 130,712,778 (GRCm39) missense probably damaging 0.99
cavity UTSW 7 130,713,965 (GRCm39) missense unknown
lacunar UTSW 7 130,699,361 (GRCm39) missense probably damaging 0.97
BB005:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
BB015:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
H8562:Dmbt1 UTSW 7 130,713,805 (GRCm39) nonsense probably null
K3955:Dmbt1 UTSW 7 130,721,293 (GRCm39) missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 130,721,225 (GRCm39) missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 130,721,225 (GRCm39) missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 130,708,123 (GRCm39) missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 130,697,779 (GRCm39) splice site probably benign
R0427:Dmbt1 UTSW 7 130,642,632 (GRCm39) nonsense probably null
R0478:Dmbt1 UTSW 7 130,642,917 (GRCm39) missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 130,699,403 (GRCm39) splice site probably null
R0538:Dmbt1 UTSW 7 130,651,631 (GRCm39) splice site probably benign
R0626:Dmbt1 UTSW 7 130,703,811 (GRCm39) missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 130,699,383 (GRCm39) missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 130,694,847 (GRCm39) missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 130,676,254 (GRCm39) critical splice donor site probably null
R1413:Dmbt1 UTSW 7 130,651,944 (GRCm39) missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 130,646,217 (GRCm39) splice site probably benign
R1463:Dmbt1 UTSW 7 130,711,366 (GRCm39) critical splice donor site probably null
R1509:Dmbt1 UTSW 7 130,676,061 (GRCm39) intron probably benign
R1990:Dmbt1 UTSW 7 130,660,018 (GRCm39) missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 130,712,718 (GRCm39) missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 130,712,718 (GRCm39) missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 130,708,089 (GRCm39) missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 130,700,863 (GRCm39) missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 130,651,748 (GRCm39) missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 130,703,762 (GRCm39) missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 130,699,305 (GRCm39) missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 130,648,292 (GRCm39) missense probably benign 0.03
R2256:Dmbt1 UTSW 7 130,692,224 (GRCm39) missense probably benign 0.01
R2391:Dmbt1 UTSW 7 130,708,198 (GRCm39) missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 130,696,464 (GRCm39) nonsense probably null
R3014:Dmbt1 UTSW 7 130,633,827 (GRCm39) intron probably benign
R3155:Dmbt1 UTSW 7 130,651,887 (GRCm39) nonsense probably null
R3176:Dmbt1 UTSW 7 130,689,801 (GRCm39) missense probably benign 0.19
R3276:Dmbt1 UTSW 7 130,689,801 (GRCm39) missense probably benign 0.19
R3442:Dmbt1 UTSW 7 130,707,979 (GRCm39) missense probably damaging 1.00
R4060:Dmbt1 UTSW 7 130,675,932 (GRCm39) intron probably benign
R4396:Dmbt1 UTSW 7 130,718,361 (GRCm39) missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 130,642,664 (GRCm39) missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 130,651,742 (GRCm39) missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 130,696,472 (GRCm39) missense probably benign 0.01
R5156:Dmbt1 UTSW 7 130,699,400 (GRCm39) critical splice donor site probably null
R5225:Dmbt1 UTSW 7 130,696,465 (GRCm39) missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 130,684,349 (GRCm39) missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 130,642,751 (GRCm39) missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 130,721,240 (GRCm39) missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 130,642,723 (GRCm39) missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 130,665,133 (GRCm39) intron probably benign
R5526:Dmbt1 UTSW 7 130,642,920 (GRCm39) missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 130,701,030 (GRCm39) nonsense probably null
R5566:Dmbt1 UTSW 7 130,708,003 (GRCm39) missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 130,655,797 (GRCm39) missense probably benign 0.17
R6154:Dmbt1 UTSW 7 130,711,370 (GRCm39) splice site probably null
R6188:Dmbt1 UTSW 7 130,699,361 (GRCm39) missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 130,668,463 (GRCm39) missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 130,668,463 (GRCm39) missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 130,659,984 (GRCm39) missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 130,705,308 (GRCm39) missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 130,718,370 (GRCm39) missense probably benign 0.01
R6603:Dmbt1 UTSW 7 130,648,240 (GRCm39) splice site probably null
R6719:Dmbt1 UTSW 7 130,721,332 (GRCm39) missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 130,648,291 (GRCm39) missense probably benign 0.16
R7148:Dmbt1 UTSW 7 130,668,464 (GRCm39) nonsense probably null
R7191:Dmbt1 UTSW 7 130,646,250 (GRCm39) missense unknown
R7269:Dmbt1 UTSW 7 130,668,351 (GRCm39) missense unknown
R7288:Dmbt1 UTSW 7 130,685,519 (GRCm39) nonsense probably null
R7296:Dmbt1 UTSW 7 130,713,861 (GRCm39) missense unknown
R7349:Dmbt1 UTSW 7 130,642,854 (GRCm39) missense unknown
R7386:Dmbt1 UTSW 7 130,713,965 (GRCm39) missense unknown
R7428:Dmbt1 UTSW 7 130,710,192 (GRCm39) missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 130,681,241 (GRCm39) critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 130,668,192 (GRCm39) missense unknown
R7513:Dmbt1 UTSW 7 130,692,242 (GRCm39) missense unknown
R7553:Dmbt1 UTSW 7 130,706,597 (GRCm39) missense unknown
R7567:Dmbt1 UTSW 7 130,663,093 (GRCm39) splice site probably null
R7584:Dmbt1 UTSW 7 130,690,481 (GRCm39) nonsense probably null
R7736:Dmbt1 UTSW 7 130,718,625 (GRCm39) missense unknown
R7758:Dmbt1 UTSW 7 130,722,926 (GRCm39) missense unknown
R7928:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
R8080:Dmbt1 UTSW 7 130,690,500 (GRCm39) missense unknown
R8098:Dmbt1 UTSW 7 130,710,188 (GRCm39) nonsense probably null
R8125:Dmbt1 UTSW 7 130,700,953 (GRCm39) missense unknown
R8177:Dmbt1 UTSW 7 130,708,162 (GRCm39) missense possibly damaging 0.46
R8350:Dmbt1 UTSW 7 130,687,147 (GRCm39) critical splice donor site probably null
R8366:Dmbt1 UTSW 7 130,668,330 (GRCm39) missense unknown
R8378:Dmbt1 UTSW 7 130,708,195 (GRCm39) missense probably damaging 0.96
R8399:Dmbt1 UTSW 7 130,684,317 (GRCm39) missense unknown
R8400:Dmbt1 UTSW 7 130,684,317 (GRCm39) missense unknown
R8445:Dmbt1 UTSW 7 130,692,110 (GRCm39) missense unknown
R8450:Dmbt1 UTSW 7 130,687,147 (GRCm39) critical splice donor site probably null
R8511:Dmbt1 UTSW 7 130,703,742 (GRCm39) missense unknown
R8688:Dmbt1 UTSW 7 130,659,984 (GRCm39) missense unknown
R8850:Dmbt1 UTSW 7 130,692,134 (GRCm39) missense unknown
R8852:Dmbt1 UTSW 7 130,642,853 (GRCm39) missense unknown
R8871:Dmbt1 UTSW 7 130,718,597 (GRCm39) missense unknown
R8943:Dmbt1 UTSW 7 130,721,372 (GRCm39) missense possibly damaging 0.68
R8978:Dmbt1 UTSW 7 130,639,611 (GRCm39) missense possibly damaging 0.53
R9004:Dmbt1 UTSW 7 130,713,798 (GRCm39) missense unknown
R9020:Dmbt1 UTSW 7 130,712,787 (GRCm39) missense possibly damaging 0.86
R9088:Dmbt1 UTSW 7 130,718,418 (GRCm39) missense unknown
R9230:Dmbt1 UTSW 7 130,639,642 (GRCm39) missense probably benign 0.01
R9304:Dmbt1 UTSW 7 130,700,855 (GRCm39) missense unknown
R9377:Dmbt1 UTSW 7 130,694,832 (GRCm39) missense unknown
R9428:Dmbt1 UTSW 7 130,668,208 (GRCm39) missense unknown
R9474:Dmbt1 UTSW 7 130,675,987 (GRCm39) missense unknown
R9573:Dmbt1 UTSW 7 130,657,910 (GRCm39) critical splice donor site probably null
R9675:Dmbt1 UTSW 7 130,712,652 (GRCm39) missense probably damaging 0.98
R9689:Dmbt1 UTSW 7 130,660,015 (GRCm39) missense unknown
R9781:Dmbt1 UTSW 7 130,639,599 (GRCm39) missense probably benign 0.00
X0024:Dmbt1 UTSW 7 130,713,977 (GRCm39) nonsense probably null
X0062:Dmbt1 UTSW 7 130,696,581 (GRCm39) missense possibly damaging 0.81
Z1176:Dmbt1 UTSW 7 130,690,542 (GRCm39) missense unknown
Z1177:Dmbt1 UTSW 7 130,684,215 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGGGCATTCCTGAGATGAGG -3'
(R):5'- TGACTAAAGAAAGCATGCTCAGTG -3'

Sequencing Primer
(F):5'- TACCCTCGGAGCCATAGTGACTC -3'
(R):5'- CATGCTCAGTGGGAAATAGAGTG -3'
Posted On 2015-04-02