Incidental Mutation 'R3807:Arhgap42'
ID274982
Institutional Source Beutler Lab
Gene Symbol Arhgap42
Ensembl Gene ENSMUSG00000050730
Gene NameRho GTPase activating protein 42
Synonyms9030420J04Rik
MMRRC Submission 040764-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R3807 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location8994329-9239101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9008033 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 563 (I563T)
Ref Sequence ENSEMBL: ENSMUSP00000091419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093893]
Predicted Effect probably damaging
Transcript: ENSMUST00000093893
AA Change: I563T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091419
Gene: ENSMUSG00000050730
AA Change: I563T

DomainStartEndE-ValueType
Pfam:BAR_3 6 132 4.4e-36 PFAM
Pfam:BAR_3 125 215 8.9e-29 PFAM
PH 232 342 5.5e-8 SMART
RhoGAP 358 535 1.4e-55 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 599 616 N/A INTRINSIC
Blast:RhoGAP 617 691 2e-37 BLAST
low complexity region 692 711 N/A INTRINSIC
SH3 786 840 7.4e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182617
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit hypertension and increased vascular smooth muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Other mutations in Arhgap42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Arhgap42 APN 9 9006343 missense probably damaging 1.00
IGL00576:Arhgap42 APN 9 8997620 nonsense probably null
IGL01693:Arhgap42 APN 9 9006506 missense probably damaging 1.00
IGL01724:Arhgap42 APN 9 8998253 splice site probably benign
IGL02142:Arhgap42 APN 9 9155359 missense probably damaging 1.00
IGL02378:Arhgap42 APN 9 9035583 missense possibly damaging 0.94
IGL02932:Arhgap42 APN 9 9115708 missense probably damaging 0.98
IGL02992:Arhgap42 APN 9 8998248 splice site probably benign
IGL03149:Arhgap42 APN 9 9008084 missense possibly damaging 0.71
R0096:Arhgap42 UTSW 9 9009313 missense probably damaging 1.00
R0096:Arhgap42 UTSW 9 9009313 missense probably damaging 1.00
R0417:Arhgap42 UTSW 9 9180033 missense possibly damaging 0.55
R0513:Arhgap42 UTSW 9 9005765 missense probably benign 0.07
R1212:Arhgap42 UTSW 9 9015312 missense probably damaging 1.00
R1493:Arhgap42 UTSW 9 9030797 missense probably benign 0.01
R1499:Arhgap42 UTSW 9 9033586 splice site probably benign
R1674:Arhgap42 UTSW 9 9006584 missense probably damaging 0.99
R1687:Arhgap42 UTSW 9 9035537 missense probably benign 0.33
R1808:Arhgap42 UTSW 9 9180050 missense probably damaging 0.99
R1983:Arhgap42 UTSW 9 9017017 missense probably damaging 1.00
R2069:Arhgap42 UTSW 9 9035600 missense probably damaging 1.00
R2276:Arhgap42 UTSW 9 9035511 missense probably benign
R2279:Arhgap42 UTSW 9 9035511 missense probably benign
R2295:Arhgap42 UTSW 9 9115744 missense probably damaging 0.99
R4133:Arhgap42 UTSW 9 9011299 intron probably benign
R4304:Arhgap42 UTSW 9 9006488 missense probably benign
R4530:Arhgap42 UTSW 9 9011432 missense probably damaging 1.00
R4532:Arhgap42 UTSW 9 9011432 missense probably damaging 1.00
R4786:Arhgap42 UTSW 9 9238698 nonsense probably null
R4807:Arhgap42 UTSW 9 9046628 missense possibly damaging 0.70
R4809:Arhgap42 UTSW 9 9180117 missense probably damaging 0.99
R4999:Arhgap42 UTSW 9 9009434 missense probably damaging 1.00
R5160:Arhgap42 UTSW 9 8997655 missense probably damaging 0.97
R5737:Arhgap42 UTSW 9 9059068 missense probably damaging 0.98
R5840:Arhgap42 UTSW 9 9046517 missense possibly damaging 0.94
R6172:Arhgap42 UTSW 9 9148245 missense possibly damaging 0.71
R6456:Arhgap42 UTSW 9 9005822 missense probably benign
R6782:Arhgap42 UTSW 9 9115720 missense probably damaging 0.99
R6846:Arhgap42 UTSW 9 9006445 missense probably damaging 1.00
R7489:Arhgap42 UTSW 9 9006358 missense probably benign
R7560:Arhgap42 UTSW 9 9035531 missense probably benign 0.00
X0066:Arhgap42 UTSW 9 9115700 missense probably damaging 1.00
X0066:Arhgap42 UTSW 9 9115704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACTGTCTCAGTTCTAGAAG -3'
(R):5'- AGGTCTCTCCTGTACTGCTAGG -3'

Sequencing Primer
(F):5'- ACTGTCTCAGTTCTAGAAGAGGGG -3'
(R):5'- CTCCTGTACTGCTAGGATGCG -3'
Posted On2015-04-02