Incidental Mutation 'R3807:Gm11595'
ID274987
Institutional Source Beutler Lab
Gene Symbol Gm11595
Ensembl Gene ENSMUSG00000078668
Gene Namepredicted gene 11595
Synonyms
MMRRC Submission 040764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3807 (G1)
Quality Score175
Status Not validated
Chromosome11
Chromosomal Location99771714-99772913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99772554 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 100 (R100H)
Ref Sequence ENSEMBL: ENSMUSP00000103064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107440]
Predicted Effect unknown
Transcript: ENSMUST00000107440
AA Change: R100H
SMART Domains Protein: ENSMUSP00000103064
Gene: ENSMUSG00000078668
AA Change: R100H

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 7.5e-9 PFAM
Pfam:Keratin_B2_2 14 58 2.8e-13 PFAM
Pfam:Keratin_B2_2 29 73 1.2e-13 PFAM
Pfam:Keratin_B2_2 72 112 2.3e-12 PFAM
Pfam:Keratin_B2_2 107 152 4.6e-14 PFAM
Pfam:Keratin_B2_2 118 162 1.1e-13 PFAM
Pfam:Keratin_B2_2 143 187 3.5e-10 PFAM
Pfam:Keratin_B2_2 168 212 5.6e-13 PFAM
Pfam:Keratin_B2_2 178 222 2.4e-12 PFAM
Pfam:Keratin_B2_2 208 257 1.6e-11 PFAM
Pfam:Keratin_B2_2 223 267 4e-14 PFAM
Pfam:Keratin_B2_2 248 289 9e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Other mutations in Gm11595
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gm11595 APN 11 99772042 missense unknown
IGL00987:Gm11595 APN 11 99772539 missense unknown
IGL01662:Gm11595 APN 11 99772672 missense unknown
IGL01994:Gm11595 APN 11 99772201 missense unknown
R0548:Gm11595 UTSW 11 99772141 missense unknown
R1923:Gm11595 UTSW 11 99772539 missense unknown
R2127:Gm11595 UTSW 11 99772501 missense unknown
R2128:Gm11595 UTSW 11 99772501 missense unknown
R4007:Gm11595 UTSW 11 99772035 missense unknown
R5281:Gm11595 UTSW 11 99772555 missense unknown
R5283:Gm11595 UTSW 11 99772555 missense unknown
R5303:Gm11595 UTSW 11 99772555 missense unknown
R5305:Gm11595 UTSW 11 99772555 missense unknown
R5306:Gm11595 UTSW 11 99772555 missense unknown
R5307:Gm11595 UTSW 11 99772555 missense unknown
R5308:Gm11595 UTSW 11 99772555 missense unknown
R5561:Gm11595 UTSW 11 99772555 missense unknown
R5637:Gm11595 UTSW 11 99772555 missense unknown
R5639:Gm11595 UTSW 11 99772555 missense unknown
R5718:Gm11595 UTSW 11 99772555 missense unknown
R5719:Gm11595 UTSW 11 99772555 missense unknown
R5720:Gm11595 UTSW 11 99772555 missense unknown
R5721:Gm11595 UTSW 11 99772555 missense unknown
R5769:Gm11595 UTSW 11 99772555 missense unknown
R5770:Gm11595 UTSW 11 99772555 missense unknown
R5771:Gm11595 UTSW 11 99772555 missense unknown
R5791:Gm11595 UTSW 11 99772555 missense unknown
R5841:Gm11595 UTSW 11 99772317 missense unknown
R6054:Gm11595 UTSW 11 99772648 missense unknown
R6277:Gm11595 UTSW 11 99772684 missense unknown
R6281:Gm11595 UTSW 11 99772555 missense unknown
R6282:Gm11595 UTSW 11 99772555 missense unknown
R6310:Gm11595 UTSW 11 99772555 missense unknown
R6321:Gm11595 UTSW 11 99772555 missense unknown
R6322:Gm11595 UTSW 11 99772555 missense unknown
R6327:Gm11595 UTSW 11 99772555 missense unknown
R6337:Gm11595 UTSW 11 99772555 missense unknown
R6368:Gm11595 UTSW 11 99772555 missense unknown
R6369:Gm11595 UTSW 11 99772555 missense unknown
R6431:Gm11595 UTSW 11 99772774 missense unknown
R6483:Gm11595 UTSW 11 99772555 missense unknown
R6485:Gm11595 UTSW 11 99772555 missense unknown
R6493:Gm11595 UTSW 11 99772555 missense unknown
R6758:Gm11595 UTSW 11 99772540 missense unknown
R6758:Gm11595 UTSW 11 99772541 nonsense probably null
R7037:Gm11595 UTSW 11 99772648 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGAACTACCACAGCAGGGG -3'
(R):5'- ACCATGGTCAGTTCCTGTTG -3'

Sequencing Primer
(F):5'- GCGACAGCAGCTGGAGATG -3'
(R):5'- TGCCAGACCACCTGCTGTAG -3'
Posted On2015-04-02