Incidental Mutation 'R3807:Tfrc'
ID274995
Institutional Source Beutler Lab
Gene Symbol Tfrc
Ensembl Gene ENSMUSG00000022797
Gene Nametransferrin receptor
SynonymsMtvr-1, E430033M20Rik, Mtvr1, Trfr, 2610028K12Rik, p90, TfR1, CD71
MMRRC Submission 040764-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3807 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32608920-32632794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32616826 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 173 (N173I)
Ref Sequence ENSEMBL: ENSMUSP00000113028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023486] [ENSMUST00000120680] [ENSMUST00000124243]
Predicted Effect probably benign
Transcript: ENSMUST00000023486
AA Change: N173I

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023486
Gene: ENSMUSG00000022797
AA Change: N173I

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:PA 229 348 1.1e-12 PFAM
Pfam:Peptidase_M28 390 597 1e-13 PFAM
Pfam:TFR_dimer 640 753 3.4e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120680
AA Change: N173I

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113028
Gene: ENSMUSG00000022797
AA Change: N173I

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:PA 225 349 9.2e-11 PFAM
Pfam:Peptidase_M28 403 502 3.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231912
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a cell surface receptor necessary for cellular iron uptake by the process of receptor-mediated endocytosis. This receptor is required for erythropoiesis and neurologic development. Mice that are deficient in this receptor show impaired erythroid development and abnormal iron homeostasis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant embryos do not survive past E12.5, exhibiting anemia, hydrops fetalis, and neurological defects. Haploinsufficiency results in abnromal erythrocytes and tissue iron deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Other mutations in Tfrc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Tfrc APN 16 32624828 critical splice donor site probably null
IGL01553:Tfrc APN 16 32628585 missense probably benign 0.07
IGL01667:Tfrc APN 16 32624443 unclassified probably benign
IGL01761:Tfrc APN 16 32628551 missense probably damaging 1.00
IGL02085:Tfrc APN 16 32621186 missense probably benign 0.14
IGL02093:Tfrc APN 16 32630194 missense probably benign 0.06
IGL02401:Tfrc APN 16 32617181 missense probably damaging 1.00
IGL02548:Tfrc APN 16 32624822 nonsense probably null
IGL02715:Tfrc APN 16 32624371 missense probably benign
IGL03157:Tfrc APN 16 32620405 missense probably benign 0.00
IGL03242:Tfrc APN 16 32630112 missense probably damaging 1.00
IGL03410:Tfrc APN 16 32624831 splice site probably null
R0034:Tfrc UTSW 16 32615396 critical splice donor site probably null
R0098:Tfrc UTSW 16 32623426 missense probably damaging 0.98
R0098:Tfrc UTSW 16 32623426 missense probably damaging 0.98
R0508:Tfrc UTSW 16 32630179 missense probably damaging 1.00
R1474:Tfrc UTSW 16 32626649 missense probably damaging 0.99
R1613:Tfrc UTSW 16 32623375 missense probably damaging 1.00
R1694:Tfrc UTSW 16 32614625 missense probably damaging 0.99
R2430:Tfrc UTSW 16 32626711 missense probably damaging 1.00
R4613:Tfrc UTSW 16 32618657 missense probably damaging 1.00
R4661:Tfrc UTSW 16 32630151 missense probably damaging 0.99
R4974:Tfrc UTSW 16 32618279 missense probably damaging 0.99
R5138:Tfrc UTSW 16 32615209 nonsense probably null
R5668:Tfrc UTSW 16 32623376 missense probably damaging 1.00
R5867:Tfrc UTSW 16 32620412 missense possibly damaging 0.71
R5942:Tfrc UTSW 16 32626715 missense possibly damaging 0.65
R6185:Tfrc UTSW 16 32618272 missense probably benign 0.19
R6417:Tfrc UTSW 16 32630239 missense probably damaging 0.99
R7453:Tfrc UTSW 16 32619049 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTCAGTAACTGGTTAATCTAGCAG -3'
(R):5'- TCACCATGTTTTGACCAATGC -3'

Sequencing Primer
(F):5'- TGGTCAATCCAAGTACTCATGGG -3'
(R):5'- GCATTTGACTTGCATTGATTAGC -3'
Posted On2015-04-02