Incidental Mutation 'R3807:Pcdhb4'
ID274999
Institutional Source Beutler Lab
Gene Symbol Pcdhb4
Ensembl Gene ENSMUSG00000045689
Gene Nameprotocadherin beta 4
SynonymsPcdhbD, Pcdhb5A
MMRRC Submission 040764-MU
Accession Numbers

Ncbi RefSeq: NM_053129.3; MGI:2136738

Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3807 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37307455-37311172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37309314 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 559 (F559S)
Ref Sequence ENSEMBL: ENSMUSP00000059770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056712] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051754
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056712
AA Change: F559S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059770
Gene: ENSMUSG00000045689
AA Change: F559S

DomainStartEndE-ValueType
CA 54 131 1.66e0 SMART
CA 155 240 1.07e-19 SMART
CA 264 344 6.03e-28 SMART
CA 367 448 2.57e-22 SMART
CA 472 558 3.36e-26 SMART
CA 588 669 3.48e-10 SMART
Pfam:Cadherin_C_2 685 768 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193025
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Other mutations in Pcdhb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Pcdhb4 APN 18 37309916 missense possibly damaging 0.68
IGL01319:Pcdhb4 APN 18 37308513 missense probably benign
IGL01325:Pcdhb4 APN 18 37309623 missense probably damaging 1.00
IGL01608:Pcdhb4 APN 18 37308750 missense probably damaging 1.00
IGL01808:Pcdhb4 APN 18 37309014 missense probably damaging 1.00
IGL01962:Pcdhb4 APN 18 37309004 missense possibly damaging 0.90
IGL02280:Pcdhb4 APN 18 37307682 missense probably benign 0.00
IGL02622:Pcdhb4 APN 18 37309668 missense probably benign 0.00
IGL03025:Pcdhb4 APN 18 37309977 missense possibly damaging 0.62
IGL03137:Pcdhb4 APN 18 37308516 missense probably damaging 0.98
P0031:Pcdhb4 UTSW 18 37308885 missense probably damaging 1.00
R0385:Pcdhb4 UTSW 18 37309215 missense probably damaging 1.00
R0611:Pcdhb4 UTSW 18 37308210 missense probably damaging 1.00
R0671:Pcdhb4 UTSW 18 37307742 missense probably benign 0.01
R0738:Pcdhb4 UTSW 18 37308711 missense probably damaging 1.00
R0853:Pcdhb4 UTSW 18 37309885 nonsense probably null
R0893:Pcdhb4 UTSW 18 37309370 unclassified probably null
R1932:Pcdhb4 UTSW 18 37309541 missense probably benign 0.33
R1945:Pcdhb4 UTSW 18 37308868 missense probably damaging 1.00
R2194:Pcdhb4 UTSW 18 37308735 missense probably damaging 1.00
R2273:Pcdhb4 UTSW 18 37308926 missense probably damaging 1.00
R3815:Pcdhb4 UTSW 18 37308012 missense probably damaging 1.00
R3816:Pcdhb4 UTSW 18 37308012 missense probably damaging 1.00
R3974:Pcdhb4 UTSW 18 37308848 missense possibly damaging 0.55
R4558:Pcdhb4 UTSW 18 37309964 missense probably benign
R4606:Pcdhb4 UTSW 18 37308652 missense probably damaging 1.00
R4615:Pcdhb4 UTSW 18 37308500 missense probably benign 0.02
R4840:Pcdhb4 UTSW 18 37308399 missense possibly damaging 0.60
R5240:Pcdhb4 UTSW 18 37309926 missense possibly damaging 0.78
R5272:Pcdhb4 UTSW 18 37307766 missense probably benign 0.04
R5586:Pcdhb4 UTSW 18 37308981 missense probably damaging 1.00
R5683:Pcdhb4 UTSW 18 37308989 missense probably benign 0.45
R5917:Pcdhb4 UTSW 18 37309566 missense probably damaging 1.00
R6110:Pcdhb4 UTSW 18 37308429 missense possibly damaging 0.80
R6383:Pcdhb4 UTSW 18 37308021 missense probably damaging 1.00
R6877:Pcdhb4 UTSW 18 37309572 missense probably damaging 1.00
R7036:Pcdhb4 UTSW 18 37308782 missense possibly damaging 0.95
R7204:Pcdhb4 UTSW 18 37309239 missense probably damaging 1.00
R7271:Pcdhb4 UTSW 18 37308169 missense possibly damaging 0.89
R7436:Pcdhb4 UTSW 18 37309275 missense probably damaging 1.00
R7444:Pcdhb4 UTSW 18 37309452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATCAACGCTGACAACGG -3'
(R):5'- CATTGTCCTTGACCAGCAACAG -3'

Sequencing Primer
(F):5'- ACAACGGGCAGCTGTTTG -3'
(R):5'- CAACCTGTGCTTGGGTGCATC -3'
Posted On2015-04-02