Incidental Mutation 'R3807:Zfp518a'
ID275001
Institutional Source Beutler Lab
Gene Symbol Zfp518a
Ensembl Gene ENSMUSG00000049164
Gene Namezinc finger protein 518A
Synonyms6330417C12Rik, 2810401C22Rik, Zfp518
MMRRC Submission 040764-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.891) question?
Stock #R3807 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location40894705-40917947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40914797 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1057 (K1057E)
Ref Sequence ENSEMBL: ENSMUSP00000055956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050092]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050092
AA Change: K1057E

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055956
Gene: ENSMUSG00000049164
AA Change: K1057E

DomainStartEndE-ValueType
ZnF_C2H2 121 146 1.38e2 SMART
ZnF_C2H2 152 174 4.98e-1 SMART
ZnF_C2H2 179 203 6.75e0 SMART
ZnF_C2H2 209 231 4.34e-1 SMART
ZnF_C2H2 236 258 1.33e-1 SMART
ZnF_C2H2 264 287 9.44e-2 SMART
low complexity region 308 319 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
low complexity region 544 563 N/A INTRINSIC
low complexity region 671 680 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1147 1164 N/A INTRINSIC
low complexity region 1417 1424 N/A INTRINSIC
ZnF_C2H2 1444 1466 1.33e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the krueppel C2H2-type zinc finger protein family. The encoded protein contains five zinc fingers and is likely a nuclear transcriptional regulator. Numerous transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Other mutations in Zfp518a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Zfp518a APN 19 40913470 missense probably damaging 0.99
IGL00647:Zfp518a APN 19 40914686 missense probably damaging 1.00
IGL01468:Zfp518a APN 19 40916031 missense probably benign 0.25
IGL02079:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02080:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02437:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02466:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02470:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02471:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02472:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02500:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02537:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02537:Zfp518a APN 19 40915430 missense probably benign 0.05
IGL02546:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02547:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02561:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02568:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02583:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02584:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02586:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02589:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02614:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02732:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02961:Zfp518a APN 19 40915018 missense probably benign 0.44
IGL02985:Zfp518a APN 19 40913667 missense possibly damaging 0.92
R0137:Zfp518a UTSW 19 40915866 missense probably damaging 1.00
R0218:Zfp518a UTSW 19 40912628 missense probably benign 0.25
R0367:Zfp518a UTSW 19 40912221 missense probably damaging 1.00
R0575:Zfp518a UTSW 19 40912315 missense probably damaging 1.00
R1418:Zfp518a UTSW 19 40914359 missense probably damaging 1.00
R1795:Zfp518a UTSW 19 40915556 missense probably benign 0.05
R1965:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R2076:Zfp518a UTSW 19 40914327 missense probably damaging 1.00
R3796:Zfp518a UTSW 19 40915310 missense probably damaging 1.00
R3799:Zfp518a UTSW 19 40915310 missense probably damaging 1.00
R3904:Zfp518a UTSW 19 40914920 nonsense probably null
R3959:Zfp518a UTSW 19 40912698 missense probably damaging 1.00
R4630:Zfp518a UTSW 19 40912979 nonsense probably null
R4662:Zfp518a UTSW 19 40911860 missense probably benign 0.01
R4844:Zfp518a UTSW 19 40914896 missense probably damaging 0.99
R4911:Zfp518a UTSW 19 40915528 missense probably benign 0.04
R4934:Zfp518a UTSW 19 40914263 missense probably benign 0.01
R4964:Zfp518a UTSW 19 40915851 missense possibly damaging 0.94
R4966:Zfp518a UTSW 19 40915851 missense possibly damaging 0.94
R5373:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R5374:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R5378:Zfp518a UTSW 19 40915856 missense probably damaging 1.00
R5509:Zfp518a UTSW 19 40915401 missense possibly damaging 0.60
R5891:Zfp518a UTSW 19 40912433 missense probably damaging 1.00
R6187:Zfp518a UTSW 19 40915446 missense probably benign 0.03
R6259:Zfp518a UTSW 19 40912781 missense probably benign 0.01
R6260:Zfp518a UTSW 19 40914123 missense probably benign 0.00
R6763:Zfp518a UTSW 19 40913748 missense probably damaging 1.00
R7419:Zfp518a UTSW 19 40913763 missense possibly damaging 0.94
R7448:Zfp518a UTSW 19 40914157 missense possibly damaging 0.70
X0028:Zfp518a UTSW 19 40914933 missense possibly damaging 0.61
X0065:Zfp518a UTSW 19 40914182 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCACGGTGAAGACTGAGAATG -3'
(R):5'- TGGACTAACTTAGGCTTAAGCAG -3'

Sequencing Primer
(F):5'- TACGGAACTGTGACTAAGGAACCTTG -3'
(R):5'- GTTTAGTGTTATTTGGCATCACACAC -3'
Posted On2015-04-02