Incidental Mutation 'R3808:Cers1'
ID275039
Institutional Source Beutler Lab
Gene Symbol Cers1
Ensembl Gene ENSMUSG00000087408
Gene Nameceramide synthase 1
SynonymsCerS1, to, Uog-1, Lass1
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R3808 (G1)
Quality Score124
Status Not validated
Chromosome8
Chromosomal Location70315775-70331592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70330010 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 10 (D10G)
Ref Sequence ENSEMBL: ENSMUSP00000146749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000140239] [ENSMUST00000165819] [ENSMUST00000207684] [ENSMUST00000215817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046516
AA Change: D10G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045892
Gene: ENSMUSG00000055694
AA Change: D10G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 134 144 N/A INTRINSIC
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075666
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140239
SMART Domains Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
low complexity region 49 68 N/A INTRINSIC
TLC 97 311 1.24e-57 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165819
AA Change: D10G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408
AA Change: D10G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:TGFb_propeptide 33 169 7e-16 PFAM
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000207684
AA Change: D10G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000215817
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a ceramide synthase enzyme, which catalyzes the synthesis of ceramide, the hydrophobic moiety of sphingolipids. The encoded enzyme synthesizes 18-carbon (C18) ceramide in brain neurons. Mice lacking a functional copy of this gene exhibit impaired cerebellar development, locomotion and motor coordination. This protein is transcribed from a bicistronic mRNA, which also encodes growth differentiation factor 1. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for the spontaneous toppler mutation display reduced body and brain weight, a small cerebellum, progressive tremors, ataxia, impaired balance and seizures, as well as dramatic dendritic changes and severe loss of Purkinje cells, glial changes, and a shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Cers1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Cers1 APN 8 70323233 missense probably damaging 1.00
IGL01982:Cers1 APN 8 70323431 missense probably damaging 0.99
IGL02827:Cers1 APN 8 70321527 missense probably damaging 1.00
R1025:Cers1 UTSW 8 70321536 missense probably benign 0.44
R1456:Cers1 UTSW 8 70331188 missense probably damaging 1.00
R1467:Cers1 UTSW 8 70323169 missense possibly damaging 0.89
R1467:Cers1 UTSW 8 70323169 missense possibly damaging 0.89
R1764:Cers1 UTSW 8 70321491 splice site probably null
R2397:Cers1 UTSW 8 70321536 missense probably benign 0.44
R3107:Cers1 UTSW 8 70322636 missense probably benign 0.30
R3809:Cers1 UTSW 8 70330010 missense possibly damaging 0.85
R4789:Cers1 UTSW 8 70323368 missense probably damaging 0.96
R5450:Cers1 UTSW 8 70318297 missense probably damaging 0.99
R5987:Cers1 UTSW 8 70321578 missense possibly damaging 0.78
R6274:Cers1 UTSW 8 70331077 missense probably damaging 1.00
R6535:Cers1 UTSW 8 70330154 missense probably damaging 1.00
R7060:Cers1 UTSW 8 70315905 missense possibly damaging 0.86
R7152:Cers1 UTSW 8 70318251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCAGGATGCTACCCTTCTCCAG -3'
(R):5'- TAGTTCCTCCACGTGGCATG -3'

Sequencing Primer
(F):5'- AGCAGCTCCGCCTTTCAG -3'
(R):5'- CCACTCTGGCCTCCTGG -3'
Posted On2015-04-02