Incidental Mutation 'R3822:Lrrc4b'
ID275224
Institutional Source Beutler Lab
Gene Symbol Lrrc4b
Ensembl Gene ENSMUSG00000047085
Gene Nameleucine rich repeat containing 4B
SynonymsLrig4
MMRRC Submission 040884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R3822 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44429018-44463351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44462558 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 618 (V618E)
Ref Sequence ENSEMBL: ENSMUSP00000053123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035929] [ENSMUST00000058667] [ENSMUST00000127790] [ENSMUST00000135624] [ENSMUST00000146128] [ENSMUST00000152902] [ENSMUST00000156093] [ENSMUST00000156957]
PDB Structure
CRYSTAL STRUCTURE OF THE N-TERMINAL LEUCINE RICH REPEATS OF NETRIN-G LIGAND-3 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE N-TERMINAL LEUCINE RICH REPEATS AND IMMUNOGLOBULIN DOMAIN OF NETRIN-G LIGAND-3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000035929
SMART Domains Protein: ENSMUSP00000039202
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 17 128 3.8e-24 PFAM
Pfam:DUF108 174 265 2.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000058667
AA Change: V618E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000053123
Gene: ENSMUSG00000047085
AA Change: V618E

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
LRR 208 229 1.62e2 SMART
LRR_TYP 230 253 3.63e-3 SMART
LRR 254 277 9.75e0 SMART
LRR_TYP 278 301 5.29e-5 SMART
LRRCT 313 364 1.92e-3 SMART
IGc2 378 445 1.45e-9 SMART
low complexity region 462 482 N/A INTRINSIC
low complexity region 528 547 N/A INTRINSIC
transmembrane domain 573 595 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 624 644 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127790
SMART Domains Protein: ENSMUSP00000123389
Gene: ENSMUSG00000047085

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
Blast:LRR 183 207 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133801
Predicted Effect probably benign
Transcript: ENSMUST00000135624
Predicted Effect probably benign
Transcript: ENSMUST00000146128
SMART Domains Protein: ENSMUSP00000119474
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 5 110 1e-19 PFAM
Pfam:DUF108 153 252 7.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152902
Predicted Effect probably benign
Transcript: ENSMUST00000156093
SMART Domains Protein: ENSMUSP00000119374
Gene: ENSMUSG00000047085

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
Blast:LRR 183 207 2e-6 BLAST
LRR 208 230 3.65e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156957
SMART Domains Protein: ENSMUSP00000121766
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:DUF108 52 151 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207591
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Chka A G 19: 3,882,038 probably benign Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Cth A G 3: 157,918,499 F127S probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Dysf T C 6: 84,207,088 probably benign Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Gpr89 A G 3: 96,892,944 S113P probably benign Het
Herpud2 G A 9: 25,124,924 Q147* probably null Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Hlcs T C 16: 94,267,981 N274D probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Lama1 C A 17: 67,779,046 probably null Het
Man1a2 A G 3: 100,632,597 I176T possibly damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Psmb7 A T 2: 38,613,428 probably benign Het
Rin2 C T 2: 145,822,630 T60M probably benign Het
Slc28a3 A G 13: 58,558,278 V639A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpm1 A G 7: 64,217,703 probably benign Het
Ugt1a6a T A 1: 88,138,529 V19E probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Wdr4 T G 17: 31,512,221 Q55P probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfyve16 A T 13: 92,521,261 L714Q probably damaging Het
Other mutations in Lrrc4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0165:Lrrc4b UTSW 7 44462315 missense probably damaging 0.99
R1398:Lrrc4b UTSW 7 44462452 missense probably benign 0.44
R1421:Lrrc4b UTSW 7 44461051 missense probably benign 0.00
R1622:Lrrc4b UTSW 7 44462230 unclassified probably benign
R1681:Lrrc4b UTSW 7 44461177 missense probably damaging 0.99
R1778:Lrrc4b UTSW 7 44462399 missense probably benign
R1967:Lrrc4b UTSW 7 44462230 unclassified probably benign
R1989:Lrrc4b UTSW 7 44462230 unclassified probably benign
R2427:Lrrc4b UTSW 7 44462552 missense probably damaging 1.00
R3820:Lrrc4b UTSW 7 44462558 missense probably damaging 1.00
R4774:Lrrc4b UTSW 7 44462372 unclassified probably null
R5249:Lrrc4b UTSW 7 44462564 missense possibly damaging 0.93
R5268:Lrrc4b UTSW 7 44461363 missense probably damaging 1.00
R6029:Lrrc4b UTSW 7 44462330 missense probably benign 0.00
R6984:Lrrc4b UTSW 7 44461298 missense possibly damaging 0.62
R7003:Lrrc4b UTSW 7 44445156 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGCTTAAGGACCTAGACG -3'
(R):5'- CTTGAAGAGCAGAGGTTCGTG -3'

Sequencing Primer
(F):5'- CGCTTAAGGACCTAGACGATGTC -3'
(R):5'- CGTGGATGGAGTTGAGGCC -3'
Posted On2015-04-02