Incidental Mutation 'R3822:Aarsd1'
ID275238
Institutional Source Beutler Lab
Gene Symbol Aarsd1
Ensembl Gene ENSMUSG00000075528
Gene Namealanyl-tRNA synthetase domain containing 1
Synonyms2310044P18Rik
MMRRC Submission 040884-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R3822 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101406839-101417615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101411145 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 332 (I332F)
Ref Sequence ENSEMBL: ENSMUSP00000102880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070395] [ENSMUST00000107257] [ENSMUST00000107259]
Predicted Effect probably damaging
Transcript: ENSMUST00000070395
AA Change: I201F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067912
Gene: ENSMUSG00000075528
AA Change: I201F

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 8 101 1.5e-8 PFAM
tRNA_SAD 196 239 1.43e-6 SMART
low complexity region 276 293 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107257
AA Change: I314F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102878
Gene: ENSMUSG00000097239
AA Change: I314F

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 91 214 1.4e-8 PFAM
tRNA_SAD 309 352 1.43e-6 SMART
low complexity region 389 406 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107259
AA Change: I332F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102880
Gene: ENSMUSG00000097239
AA Change: I332F

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 109 232 3.4e-9 PFAM
tRNA_SAD 327 370 1.43e-6 SMART
low complexity region 407 424 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189049
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Chka A G 19: 3,882,038 probably benign Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Cth A G 3: 157,918,499 F127S probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Dysf T C 6: 84,207,088 probably benign Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Gpr89 A G 3: 96,892,944 S113P probably benign Het
Herpud2 G A 9: 25,124,924 Q147* probably null Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Hlcs T C 16: 94,267,981 N274D probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Man1a2 A G 3: 100,632,597 I176T possibly damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Psmb7 A T 2: 38,613,428 probably benign Het
Rin2 C T 2: 145,822,630 T60M probably benign Het
Slc28a3 A G 13: 58,558,278 V639A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpm1 A G 7: 64,217,703 probably benign Het
Ugt1a6a T A 1: 88,138,529 V19E probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Wdr4 T G 17: 31,512,221 Q55P probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfyve16 A T 13: 92,521,261 L714Q probably damaging Het
Other mutations in Aarsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Aarsd1 APN 11 101417359 nonsense probably null
R0462:Aarsd1 UTSW 11 101414091 missense probably damaging 1.00
R1885:Aarsd1 UTSW 11 101411401 missense probably benign 0.33
R1886:Aarsd1 UTSW 11 101411401 missense probably benign 0.33
R1909:Aarsd1 UTSW 11 101410231 intron probably null
R2382:Aarsd1 UTSW 11 101414078 missense probably damaging 0.99
R3820:Aarsd1 UTSW 11 101411145 missense probably damaging 1.00
R3821:Aarsd1 UTSW 11 101411145 missense probably damaging 1.00
R4034:Aarsd1 UTSW 11 101411332 missense probably damaging 1.00
R4701:Aarsd1 UTSW 11 101411160 missense probably benign 0.00
R5204:Aarsd1 UTSW 11 101406926 missense probably damaging 1.00
R5327:Aarsd1 UTSW 11 101410377 missense probably benign 0.30
R5554:Aarsd1 UTSW 11 101413981 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTTAGGACACAAGGGCAAG -3'
(R):5'- AAAATCAGAGACCGGCTGC -3'

Sequencing Primer
(F):5'- GGCAAGAGAGACCAGACCC -3'
(R):5'- AGTGTTCGAGAGCTGAGCC -3'
Posted On2015-04-02