Incidental Mutation 'R3824:Zfp12'
ID275273
Institutional Source Beutler Lab
Gene Symbol Zfp12
Ensembl Gene ENSMUSG00000029587
Gene Namezinc finger protein 12
SynonymsZfp-12, Krox-7
MMRRC Submission 040885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3824 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143235163-143248834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143240322 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 72 (V72A)
Ref Sequence ENSEMBL: ENSMUSP00000137971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032591] [ENSMUST00000075916] [ENSMUST00000077485] [ENSMUST00000162861]
Predicted Effect probably benign
Transcript: ENSMUST00000032591
AA Change: Y49H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032591
Gene: ENSMUSG00000029587
AA Change: Y49H

DomainStartEndE-ValueType
KRAB 8 68 1.98e-36 SMART
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 263 285 4.47e-3 SMART
ZnF_C2H2 291 313 2.43e-4 SMART
ZnF_C2H2 319 341 2.61e-4 SMART
ZnF_C2H2 347 369 1.04e-3 SMART
ZnF_C2H2 375 397 6.08e-5 SMART
ZnF_C2H2 403 425 2.99e-4 SMART
ZnF_C2H2 431 453 9.08e-4 SMART
ZnF_C2H2 459 481 2.57e-3 SMART
ZnF_C2H2 487 509 6.32e-3 SMART
ZnF_C2H2 515 537 5.21e-4 SMART
ZnF_C2H2 543 565 9.44e-2 SMART
ZnF_C2H2 571 593 1.72e-4 SMART
ZnF_C2H2 599 621 2.86e-1 SMART
ZnF_C2H2 627 649 3.63e-3 SMART
ZnF_C2H2 655 677 4.54e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075916
AA Change: V72A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137971
Gene: ENSMUSG00000029587
AA Change: V72A

DomainStartEndE-ValueType
KRAB 8 67 6.65e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077485
SMART Domains Protein: ENSMUSP00000076693
Gene: ENSMUSG00000029587

DomainStartEndE-ValueType
KRAB 8 68 8.91e-21 SMART
low complexity region 156 167 N/A INTRINSIC
Pfam:zf-C2H2_6 183 200 8.8e-1 PFAM
ZnF_C2H2 231 253 4.47e-3 SMART
ZnF_C2H2 259 281 2.43e-4 SMART
ZnF_C2H2 287 309 2.61e-4 SMART
ZnF_C2H2 315 337 1.04e-3 SMART
ZnF_C2H2 343 365 6.08e-5 SMART
ZnF_C2H2 371 393 2.99e-4 SMART
ZnF_C2H2 399 421 9.08e-4 SMART
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 6.32e-3 SMART
ZnF_C2H2 483 505 5.21e-4 SMART
ZnF_C2H2 511 533 9.44e-2 SMART
ZnF_C2H2 539 561 1.72e-4 SMART
ZnF_C2H2 567 589 2.86e-1 SMART
ZnF_C2H2 595 617 3.63e-3 SMART
ZnF_C2H2 623 645 4.54e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160195
Predicted Effect probably benign
Transcript: ENSMUST00000162861
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the krueppel C2H2-type zinc-finger protein family and encodes a protein with eight C2H2-type zinc fingers and a KRAB domain. This nuclear protein is involved in developmental control of gene expression. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,611 C20R probably benign Het
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
9430015G10Rik T A 4: 156,119,150 probably null Het
A2ml1 A G 6: 128,568,763 V467A probably damaging Het
Abcc3 T C 11: 94,368,620 probably null Het
Acad10 A T 5: 121,622,818 M941K probably benign Het
Agrn A G 4: 156,169,302 L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 R402G possibly damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Btn2a2 T A 13: 23,480,465 T308S probably benign Het
C8b G T 4: 104,783,009 A170S probably benign Het
Cabyr T A 18: 12,751,690 D411E probably benign Het
Capn3 T C 2: 120,484,483 probably benign Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Cflar T A 1: 58,735,697 Y218N probably benign Het
Col11a2 T C 17: 34,054,180 Y630H probably damaging Het
Coq6 T C 12: 84,372,415 probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fam205c A G 4: 42,873,492 probably null Het
Fry T A 5: 150,496,419 S1015R possibly damaging Het
Gjb4 A G 4: 127,351,429 S240P probably benign Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gls A C 1: 52,232,988 M2R possibly damaging Het
Gm13078 A T 4: 143,726,685 H121L probably benign Het
Gm5724 T C 6: 141,754,374 Q144R possibly damaging Het
Gm906 G A 13: 50,245,512 S926F possibly damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Ints8 A T 4: 11,225,621 Y645* probably null Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kat8 T A 7: 127,924,482 D292E possibly damaging Het
Myo19 T A 11: 84,885,679 C54S probably damaging Het
Myo5b C T 18: 74,661,655 H532Y probably benign Het
Nckap1 T C 2: 80,540,560 K357E possibly damaging Het
Ndufaf1 C T 2: 119,660,271 V105M probably benign Het
Olfr1076 T G 2: 86,509,023 L188R possibly damaging Het
Olfr1394 A G 11: 49,160,793 S260G possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Olfr904 T A 9: 38,464,526 C162S probably benign Het
Palld T C 8: 61,709,033 D439G probably damaging Het
Pcf11 T C 7: 92,659,620 probably benign Het
Pigo A T 4: 43,020,909 W678R possibly damaging Het
Pip5kl1 A T 2: 32,583,271 probably null Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Prom2 A G 2: 127,535,673 probably benign Het
Ptk7 A G 17: 46,565,378 I1049T probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Ptprm A G 17: 66,809,575 V894A probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sdk1 A G 5: 141,936,049 T267A probably benign Het
Sorcs3 T A 19: 48,722,956 D653E probably damaging Het
St8sia1 A G 6: 142,829,025 L276P probably damaging Het
Sync T C 4: 129,294,363 V396A possibly damaging Het
Taok3 A G 5: 117,255,937 T592A probably benign Het
Tas2r104 T A 6: 131,685,039 I236F possibly damaging Het
Tas2r107 A C 6: 131,659,330 I252S probably benign Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Usp24 G A 4: 106,379,066 V984I probably benign Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 T111S probably damaging Het
Vmn2r74 T G 7: 85,958,258 N86H probably damaging Het
Other mutations in Zfp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Zfp12 APN 5 143244796 missense probably damaging 1.00
IGL02870:Zfp12 APN 5 143245331 missense probably damaging 0.99
IGL02975:Zfp12 APN 5 143244059 unclassified probably benign
R0362:Zfp12 UTSW 5 143245223 missense probably damaging 0.97
R0723:Zfp12 UTSW 5 143244883 missense probably damaging 1.00
R1104:Zfp12 UTSW 5 143245745 missense probably damaging 1.00
R1403:Zfp12 UTSW 5 143244780 nonsense probably null
R1403:Zfp12 UTSW 5 143244780 nonsense probably null
R1774:Zfp12 UTSW 5 143245229 missense probably damaging 1.00
R1895:Zfp12 UTSW 5 143245378 missense probably damaging 1.00
R1946:Zfp12 UTSW 5 143245378 missense probably damaging 1.00
R2280:Zfp12 UTSW 5 143245493 missense probably damaging 0.99
R4772:Zfp12 UTSW 5 143240000 missense probably damaging 1.00
R4786:Zfp12 UTSW 5 143245502 missense probably damaging 0.99
R5255:Zfp12 UTSW 5 143240379 missense probably null 0.08
R5496:Zfp12 UTSW 5 143244795 nonsense probably null
R5542:Zfp12 UTSW 5 143244485 missense possibly damaging 0.75
R5637:Zfp12 UTSW 5 143245696 missense probably damaging 1.00
R5742:Zfp12 UTSW 5 143245190 missense probably damaging 1.00
R5907:Zfp12 UTSW 5 143239988 missense probably damaging 1.00
R6701:Zfp12 UTSW 5 143244464 missense probably benign 0.21
R7166:Zfp12 UTSW 5 143245502 missense possibly damaging 0.85
R7188:Zfp12 UTSW 5 143239994 missense probably damaging 0.99
R7285:Zfp12 UTSW 5 143244689 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGAGCAGCTTGTCCTG -3'
(R):5'- AGCTAGGAACCTTTGATTGTGG -3'

Sequencing Primer
(F):5'- TGACTCCCAGAAGGTCTTGAC -3'
(R):5'- ACGGGTGACTGACTGCCTTC -3'
Posted On2015-04-02