Incidental Mutation 'R3824:St8sia1'
ID275279
Institutional Source Beutler Lab
Gene Symbol St8sia1
Ensembl Gene ENSMUSG00000030283
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
SynonymsST8Sia I, Siat8, Siat8a, GD3S, GD3 synthase, 9330109E03Rik, alpha-2,8-sialyltransferase
MMRRC Submission 040885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3824 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142821545-142964452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142829025 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 276 (L276P)
Ref Sequence ENSEMBL: ENSMUSP00000032421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032421] [ENSMUST00000205149]
Predicted Effect probably damaging
Transcript: ENSMUST00000032421
AA Change: L276P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032421
Gene: ENSMUSG00000030283
AA Change: L276P

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Pfam:Glyco_transf_29 90 344 8.1e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147058
Predicted Effect probably benign
Transcript: ENSMUST00000205149
SMART Domains Protein: ENSMUSP00000145148
Gene: ENSMUSG00000030283

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
transmembrane domain 76 95 N/A INTRINSIC
Meta Mutation Damage Score 0.422 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gangliosides are membrane-bound glycosphingolipids containing sialic acid. Ganglioside GD3 is known to be important for cell adhesion and growth of cultured malignant cells. The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to GM3 to produce gangliosides GD3 and GT3. The encoded protein may be found in the Golgi apparatus and is a member of glycosyltransferase family 29. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted allele are behaviorally normal with no signs of aberrant brain histology or demyelination. Homozygotes for a knock-out allele are behaviorally intact with normal nervous tissue morphology and sensitivity to Fas-mediated apoptosis but show impaired repair of damaged nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,611 C20R probably benign Het
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
9430015G10Rik T A 4: 156,119,150 probably null Het
A2ml1 A G 6: 128,568,763 V467A probably damaging Het
Abcc3 T C 11: 94,368,620 probably null Het
Acad10 A T 5: 121,622,818 M941K probably benign Het
Agrn A G 4: 156,169,302 L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 R402G possibly damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Btn2a2 T A 13: 23,480,465 T308S probably benign Het
C8b G T 4: 104,783,009 A170S probably benign Het
Cabyr T A 18: 12,751,690 D411E probably benign Het
Capn3 T C 2: 120,484,483 probably benign Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Cflar T A 1: 58,735,697 Y218N probably benign Het
Col11a2 T C 17: 34,054,180 Y630H probably damaging Het
Coq6 T C 12: 84,372,415 probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fam205c A G 4: 42,873,492 probably null Het
Fry T A 5: 150,496,419 S1015R possibly damaging Het
Gjb4 A G 4: 127,351,429 S240P probably benign Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gls A C 1: 52,232,988 M2R possibly damaging Het
Gm13078 A T 4: 143,726,685 H121L probably benign Het
Gm5724 T C 6: 141,754,374 Q144R possibly damaging Het
Gm906 G A 13: 50,245,512 S926F possibly damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Ints8 A T 4: 11,225,621 Y645* probably null Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kat8 T A 7: 127,924,482 D292E possibly damaging Het
Myo19 T A 11: 84,885,679 C54S probably damaging Het
Myo5b C T 18: 74,661,655 H532Y probably benign Het
Nckap1 T C 2: 80,540,560 K357E possibly damaging Het
Ndufaf1 C T 2: 119,660,271 V105M probably benign Het
Olfr1076 T G 2: 86,509,023 L188R possibly damaging Het
Olfr1394 A G 11: 49,160,793 S260G possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Olfr904 T A 9: 38,464,526 C162S probably benign Het
Palld T C 8: 61,709,033 D439G probably damaging Het
Pcf11 T C 7: 92,659,620 probably benign Het
Pigo A T 4: 43,020,909 W678R possibly damaging Het
Pip5kl1 A T 2: 32,583,271 probably null Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Prom2 A G 2: 127,535,673 probably benign Het
Ptk7 A G 17: 46,565,378 I1049T probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Ptprm A G 17: 66,809,575 V894A probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sdk1 A G 5: 141,936,049 T267A probably benign Het
Sorcs3 T A 19: 48,722,956 D653E probably damaging Het
Sync T C 4: 129,294,363 V396A possibly damaging Het
Taok3 A G 5: 117,255,937 T592A probably benign Het
Tas2r104 T A 6: 131,685,039 I236F possibly damaging Het
Tas2r107 A C 6: 131,659,330 I252S probably benign Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Usp24 G A 4: 106,379,066 V984I probably benign Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 T111S probably damaging Het
Vmn2r74 T G 7: 85,958,258 N86H probably damaging Het
Zfp12 T C 5: 143,240,322 V72A probably benign Het
Other mutations in St8sia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02081:St8sia1 APN 6 142829227 missense probably benign 0.00
IGL02138:St8sia1 APN 6 142963778 utr 5 prime probably benign
IGL02419:St8sia1 APN 6 142828935 missense probably damaging 1.00
IGL03407:St8sia1 APN 6 142914049 missense possibly damaging 0.80
PIT4453001:St8sia1 UTSW 6 142829252 nonsense probably null
PIT4498001:St8sia1 UTSW 6 142914122 missense probably damaging 1.00
R0167:St8sia1 UTSW 6 142914181 splice site probably benign
R0690:St8sia1 UTSW 6 142829254 missense probably damaging 1.00
R1727:St8sia1 UTSW 6 142876727 missense probably damaging 0.99
R1743:St8sia1 UTSW 6 142829016 missense probably damaging 1.00
R1937:St8sia1 UTSW 6 142963672 missense probably damaging 1.00
R2923:St8sia1 UTSW 6 142829237 missense probably damaging 1.00
R2983:St8sia1 UTSW 6 142963629 missense probably damaging 0.99
R4803:St8sia1 UTSW 6 142867923 missense probably benign 0.04
R4844:St8sia1 UTSW 6 142829270 missense possibly damaging 0.82
R4865:St8sia1 UTSW 6 142829070 missense probably damaging 1.00
R4886:St8sia1 UTSW 6 142914134 missense probably damaging 0.99
R5170:St8sia1 UTSW 6 142963708 missense probably damaging 0.99
R5519:St8sia1 UTSW 6 142963561 missense probably damaging 0.99
R5783:St8sia1 UTSW 6 142963614 missense possibly damaging 0.83
R6713:St8sia1 UTSW 6 142829282 splice site probably null
R7017:St8sia1 UTSW 6 142867906 missense probably damaging 0.98
R7144:St8sia1 UTSW 6 142876669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTGAAGATACCAAAGCTGAAGG -3'
(R):5'- ACCTGCTGTGGTCCAGAAAG -3'

Sequencing Primer
(F):5'- GAATTCCTCAGGCATGGCATG -3'
(R):5'- ACAGTTACATCTACATGCCTGC -3'
Posted On2015-04-02