Incidental Mutation 'R3826:Ccr3'
ID275415
Institutional Source Beutler Lab
Gene Symbol Ccr3
Ensembl Gene ENSMUSG00000035448
Gene Namechemokine (C-C motif) receptor 3
SynonymsCC-CKR3, MIP-1 alphaRL2, Cmkbr3, CKR3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3826 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location124021972-124031689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124029677 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 350 (T350A)
Ref Sequence ENSEMBL: ENSMUSP00000039107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039171]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039171
AA Change: T350A

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039107
Gene: ENSMUSG00000035448
AA Change: T350A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 49 320 7.9e-9 PFAM
Pfam:7tm_1 55 305 2.8e-52 PFAM
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for C-C type chemokines. It belongs to family 1 of the G protein-coupled receptors. This receptor binds and responds to a variety of chemokines, including eotaxin (CCL11), eotaxin-3 (CCL26), MCP-3 (CCL7), MCP-4 (CCL13), and RANTES (CCL5). It is highly expressed in eosinophils and basophils, and is also detected in TH1 and TH2 cells, as well as in airway epithelial cells. This receptor may contribute to the accumulation and activation of eosinophils and other inflammatory cells in the allergic airway. It is also known to be an entry co-receptor for HIV-1. This gene and seven other chemokine receptor genes form a chemokine receptor gene cluster on the chromosomal region 3p21. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in impaired eosinophil trafficking to the lungs and small intestine, and in increased bronchorestriction following methacholine challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,567,273 L377P probably damaging Het
Apc C A 18: 34,279,335 Q236K possibly damaging Het
Atn1 G A 6: 124,746,219 probably benign Het
C130079G13Rik T A 3: 59,936,475 S197T possibly damaging Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col1a2 A G 6: 4,516,960 probably benign Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dlec1 T C 9: 119,143,061 probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gas2 T C 7: 51,936,619 probably null Het
Gm9573 A G 17: 35,621,612 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hgfac C A 5: 35,048,162 D595E probably damaging Het
Kcnj10 A T 1: 172,370,049 S377C probably damaging Het
Kcnq2 C T 2: 181,104,900 V369I possibly damaging Het
Kcnt1 T C 2: 25,915,868 probably null Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Olfr1015 C T 2: 85,786,215 R235* probably null Het
Olfr1102 T A 2: 87,002,044 I25K probably damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Panx2 A G 15: 89,068,461 D377G probably damaging Het
Pcdhb10 C A 18: 37,412,417 T182N probably damaging Het
Pdha2 G T 3: 141,211,128 F206L possibly damaging Het
Pgd T C 4: 149,166,004 probably benign Het
Pgs1 C T 11: 118,019,758 probably null Het
Rere T C 4: 150,470,328 V161A probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Rubcnl C T 14: 75,032,225 L108F possibly damaging Het
Sap18b T C 8: 95,825,557 F65S probably damaging Het
Scap A G 9: 110,381,297 M925V probably benign Het
Slc7a8 A G 14: 54,737,572 I200T probably damaging Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Trio T A 15: 27,833,070 K75N probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp37 T C 4: 62,192,563 N88S probably benign Het
Zswim8 C T 14: 20,711,089 R142* probably null Het
Other mutations in Ccr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Ccr3 APN 9 124029552 missense probably damaging 1.00
IGL03388:Ccr3 APN 9 124028621 splice site probably benign
PIT4810001:Ccr3 UTSW 9 124029608 missense probably benign 0.00
R0077:Ccr3 UTSW 9 124029024 missense probably damaging 1.00
R0118:Ccr3 UTSW 9 124029610 nonsense probably null
R0504:Ccr3 UTSW 9 124029441 missense possibly damaging 0.69
R0576:Ccr3 UTSW 9 124029009 missense probably damaging 1.00
R0606:Ccr3 UTSW 9 124028802 missense probably benign 0.07
R2108:Ccr3 UTSW 9 124029299 missense possibly damaging 0.88
R4583:Ccr3 UTSW 9 124029440 missense probably benign 0.03
R4807:Ccr3 UTSW 9 124029297 missense probably damaging 1.00
R4823:Ccr3 UTSW 9 124028681 missense probably damaging 1.00
R4824:Ccr3 UTSW 9 124028772 missense probably damaging 1.00
R4932:Ccr3 UTSW 9 124029006 missense probably damaging 1.00
R5108:Ccr3 UTSW 9 124028931 missense probably benign 0.05
R5590:Ccr3 UTSW 9 124028793 missense probably damaging 1.00
R5610:Ccr3 UTSW 9 124029481 missense probably damaging 1.00
R5981:Ccr3 UTSW 9 124028783 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTGACTGAGGTGATTGCC -3'
(R):5'- TCTACTAATGATCTTGGGGTAGATG -3'

Sequencing Primer
(F):5'- ACTGAGGTGATTGCCTACAC -3'
(R):5'- TGGGGTAGATGAAGATATTCTGCAG -3'
Posted On2015-04-02