Incidental Mutation 'R3833:Itgad'
ID275476
Institutional Source Beutler Lab
Gene Symbol Itgad
Ensembl Gene ENSMUSG00000070369
Gene Nameintegrin, alpha D
SynonymsCd11d
MMRRC Submission 040888-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3833 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128154376-128223816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128186233 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 381 (T381S)
Ref Sequence ENSEMBL: ENSMUSP00000033051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033051] [ENSMUST00000106237] [ENSMUST00000177111]
Predicted Effect probably damaging
Transcript: ENSMUST00000033051
AA Change: T381S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033051
Gene: ENSMUSG00000070369
AA Change: T381S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Int_alpha 38 88 1.35e1 SMART
VWA 155 376 1.24e-36 SMART
Blast:VWA 405 436 1e-9 BLAST
Int_alpha 443 492 3.67e-3 SMART
Int_alpha 496 553 1.03e-6 SMART
Int_alpha 559 615 1.73e-13 SMART
Int_alpha 622 676 1.69e-2 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Pfam:Integrin_alpha 1165 1179 1.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106237
AA Change: T347S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101844
Gene: ENSMUSG00000070369
AA Change: T347S

DomainStartEndE-ValueType
Int_alpha 40 90 1.35e1 SMART
VWA 157 342 1.31e-44 SMART
Blast:VWA 371 402 9e-10 BLAST
Int_alpha 409 458 3.67e-3 SMART
Int_alpha 462 519 1.03e-6 SMART
Int_alpha 525 581 1.73e-13 SMART
Int_alpha 588 642 1.69e-2 SMART
transmembrane domain 1108 1130 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 4.3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177111
AA Change: T345S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135572
Gene: ENSMUSG00000070369
AA Change: T345S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Int_alpha 38 88 1.35e1 SMART
VWA 155 340 1.31e-44 SMART
Blast:VWA 369 400 9e-10 BLAST
Int_alpha 407 456 3.67e-3 SMART
Int_alpha 460 517 1.03e-6 SMART
Int_alpha 523 579 1.73e-13 SMART
Int_alpha 586 640 1.69e-2 SMART
transmembrane domain 1106 1128 N/A INTRINSIC
Pfam:Integrin_alpha 1129 1143 5.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206189
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the beta-2 integrin family of membrane glycoproteins, which are are composed of non-covalently linked alpha and beta subunits to form a heterodimer. It encodes the alpha subunit of the cell surface heterodimers and is involved in the activation and adhesion functions of leukocytes. The gene is located about 11kb downstream of the integrin subunit alpha X gene, another member of the integrin family. It is expressed in the tissue and circulating myeloid leukocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice exhibit a reduced staphylococcal enterotoxin-induced T cell response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik G A 9: 101,942,863 G161S probably damaging Het
Acp7 T C 7: 28,615,094 D282G probably benign Het
Atp10d T A 5: 72,239,225 C258S possibly damaging Het
Atp6ap1 T C X: 74,297,207 I10T possibly damaging Het
Atp6v0d2 T G 4: 19,922,395 N35H probably damaging Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Ccr1 T C 9: 123,964,287 T69A possibly damaging Het
Cenpe T G 3: 135,222,322 probably benign Het
Cps1 G A 1: 67,139,787 G53R probably damaging Het
Cstb T C 10: 78,427,350 F70L probably benign Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Cyp8b1 C A 9: 121,916,043 Q74H probably benign Het
Dennd2a G A 6: 39,506,717 P403L probably damaging Het
Dennd2a G T 6: 39,506,723 S401Y probably damaging Het
Dnaaf5 T C 5: 139,181,565 V447A possibly damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Gcn1l1 A T 5: 115,592,132 Q835L probably benign Het
Gm14409 T C 2: 177,265,205 S167G possibly damaging Het
Gtf2b T A 3: 142,771,392 D8E probably benign Het
Hao1 A T 2: 134,523,005 V234D probably damaging Het
Hephl1 T C 9: 15,069,748 E796G probably damaging Het
Herc4 A G 10: 63,245,960 I21V probably benign Het
Htt T A 5: 34,821,718 V815D probably benign Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Igsf8 G T 1: 172,318,270 A315S probably benign Het
Il1a T C 2: 129,306,679 D37G possibly damaging Het
Iqcb1 T A 16: 36,831,914 C62* probably null Het
Itpkb T C 1: 180,333,695 V462A probably benign Het
Kalrn T A 16: 34,039,889 R199* probably null Het
Kif24 G T 4: 41,395,064 A603D probably damaging Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Klrc3 A G 6: 129,643,218 L24P probably damaging Het
Lmnb1 A C 18: 56,728,526 D163A probably benign Het
Lrrc9 T C 12: 72,482,991 L912P probably damaging Het
Mageh1 A T X: 153,037,008 W111R probably damaging Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Mapt A T 11: 104,287,135 Q38L possibly damaging Het
Med12 C A X: 101,295,892 P2037Q possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Mep1b C T 18: 21,086,239 T150I possibly damaging Het
Mroh1 C T 15: 76,401,619 T71I probably benign Het
Nap1l3 A G X: 122,396,298 V241A possibly damaging Het
Pcdhga6 A T 18: 37,708,426 N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pgap1 A G 1: 54,557,465 M39T probably damaging Het
Pgc C A 17: 47,729,311 F93L probably null Het
Phf14 A G 6: 11,933,874 probably null Het
Piezo2 A G 18: 63,081,662 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Ppp1r12c T A 7: 4,482,786 probably benign Het
Pus3 G C 9: 35,566,578 G369R probably benign Het
Rhbdf2 T A 11: 116,604,424 D251V probably damaging Het
Rsad1 A G 11: 94,543,304 V366A probably benign Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Scn7a A G 2: 66,697,684 S821P probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Sdsl C A 5: 120,463,118 A30S probably benign Het
Slc26a6 C T 9: 108,855,918 T32I possibly damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Snd1 G T 6: 28,531,404 probably benign Het
Tdrd3 A G 14: 87,480,785 T201A probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Thsd1 T G 8: 22,243,116 S60A possibly damaging Het
Tmem121b C T 6: 120,492,880 G292E probably damaging Het
Trim63 A G 4: 134,321,196 N172S probably benign Het
Usp24 T C 4: 106,362,012 probably null Het
Wisp3 T C 10: 39,154,949 K193E probably benign Het
Zdhhc16 T A 19: 41,938,114 probably null Het
Zfp709 G A 8: 71,889,062 V112M probably benign Het
Other mutations in Itgad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Itgad APN 7 128203850 missense probably damaging 0.99
IGL02036:Itgad APN 7 128189821 missense possibly damaging 0.49
IGL02589:Itgad APN 7 128181711 missense probably damaging 1.00
IGL02648:Itgad APN 7 128183374 intron probably benign
IGL02735:Itgad APN 7 128193716 missense probably damaging 1.00
IGL03088:Itgad APN 7 128203032 missense probably benign 0.01
IGL03110:Itgad APN 7 128185985 missense probably damaging 1.00
R0060:Itgad UTSW 7 128202986 missense probably damaging 1.00
R0060:Itgad UTSW 7 128202986 missense probably damaging 1.00
R0184:Itgad UTSW 7 128189231 missense probably benign 0.02
R0211:Itgad UTSW 7 128204641 missense probably damaging 1.00
R0211:Itgad UTSW 7 128204641 missense probably damaging 1.00
R0282:Itgad UTSW 7 128189978 splice site probably benign
R0326:Itgad UTSW 7 128198378 missense probably benign 0.00
R0646:Itgad UTSW 7 128174004 missense possibly damaging 0.89
R0947:Itgad UTSW 7 128175693 missense probably benign 0.08
R1439:Itgad UTSW 7 128183006 missense probably benign 0.44
R1454:Itgad UTSW 7 128192137 missense probably benign 0.02
R1503:Itgad UTSW 7 128198121 missense probably benign 0.00
R1531:Itgad UTSW 7 128178370 missense probably benign 0.00
R1572:Itgad UTSW 7 128203234 missense probably damaging 1.00
R1602:Itgad UTSW 7 128190939 missense probably damaging 1.00
R1732:Itgad UTSW 7 128205107 missense probably benign
R2278:Itgad UTSW 7 128205170 missense possibly damaging 0.93
R2851:Itgad UTSW 7 128204560 missense probably benign 0.01
R3029:Itgad UTSW 7 128178371 missense possibly damaging 0.85
R3080:Itgad UTSW 7 128185787 missense possibly damaging 0.48
R3150:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3176:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3177:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3276:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3277:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R4541:Itgad UTSW 7 128198115 missense probably benign 0.13
R4649:Itgad UTSW 7 128189531 missense probably benign 0.01
R4753:Itgad UTSW 7 128223703 makesense probably null
R4852:Itgad UTSW 7 128198530 missense probably damaging 1.00
R4931:Itgad UTSW 7 128204625 missense probably damaging 1.00
R4970:Itgad UTSW 7 128189843 missense possibly damaging 0.70
R5116:Itgad UTSW 7 128203893 missense probably damaging 1.00
R5183:Itgad UTSW 7 128198223 critical splice donor site probably null
R5233:Itgad UTSW 7 128193428 splice site probably null
R5334:Itgad UTSW 7 128189286 missense probably damaging 0.99
R5731:Itgad UTSW 7 128198554 missense probably benign 0.19
R5760:Itgad UTSW 7 128203365 missense probably benign 0.02
R5896:Itgad UTSW 7 128174016 missense probably benign 0.34
R5955:Itgad UTSW 7 128189481 missense probably benign 0.00
R6247:Itgad UTSW 7 128185787 missense possibly damaging 0.48
R6659:Itgad UTSW 7 128185948 missense probably damaging 1.00
R7027:Itgad UTSW 7 128182989 missense probably damaging 1.00
R7104:Itgad UTSW 7 128198378 missense probably benign 0.00
R7120:Itgad UTSW 7 128173974 start codon destroyed probably null 0.02
R7272:Itgad UTSW 7 128205073 missense probably damaging 1.00
R7303:Itgad UTSW 7 128190179 missense probably benign
R7324:Itgad UTSW 7 128189807 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGGATCAAGCTCTAGCC -3'
(R):5'- TTCCGTGAAAGAGCTTCGG -3'

Sequencing Primer
(F):5'- CTCTAGCCTTAGAGCTGAGGG -3'
(R):5'- ATCCCCAGATTGTGAATGGC -3'
Posted On2015-04-06