Incidental Mutation 'R3834:Cyp2d34'
ID275559
Institutional Source Beutler Lab
Gene Symbol Cyp2d34
Ensembl Gene ENSMUSG00000094559
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 34
Synonyms
MMRRC Submission 040889-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3834 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82615965-82620946 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 82616746 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109515] [ENSMUST00000229833]
Predicted Effect probably null
Transcript: ENSMUST00000109515
SMART Domains Protein: ENSMUSP00000105141
Gene: ENSMUSG00000094559

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:p450 37 497 3.2e-141 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184667
Predicted Effect probably benign
Transcript: ENSMUST00000229833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231012
Meta Mutation Damage Score 0.504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adh6a G A 3: 138,327,514 probably null Het
Bptf T C 11: 107,073,857 T1389A probably benign Het
Cfap54 A G 10: 92,801,123 probably benign Het
Coq5 G T 5: 115,284,576 G180W probably damaging Het
Cyp2j13 C T 4: 96,056,557 probably null Het
Fam114a1 C T 5: 65,006,073 T197I possibly damaging Het
Fbxo44 A G 4: 148,156,250 Y227H probably damaging Het
Gm5114 T A 7: 39,408,737 H486L possibly damaging Het
Grik4 T C 9: 42,629,123 R254G probably benign Het
Iqcm T C 8: 75,577,752 I47T possibly damaging Het
Kif20b A G 19: 34,935,028 Y278C probably damaging Het
Lbhd1 G A 19: 8,884,057 C43Y probably benign Het
Lrfn5 T A 12: 61,840,030 D201E probably damaging Het
Map1a G A 2: 121,307,322 G2635D probably damaging Het
Ms4a4a A T 19: 11,378,855 M35L probably benign Het
Muc5b A T 7: 141,859,181 I1955F unknown Het
Mug2 T C 6: 122,049,787 probably null Het
Nav2 T A 7: 49,545,858 I994N possibly damaging Het
Ngly1 T C 14: 16,290,766 probably benign Het
Nr1i2 T C 16: 38,253,929 probably null Het
Olfr494 A T 7: 108,368,072 D194V probably damaging Het
Olfr561 A G 7: 102,775,286 Y254C probably damaging Het
Olfr651 T A 7: 104,553,345 V142D probably benign Het
Oxct2a C T 4: 123,322,473 V372I probably benign Het
Pax6 G A 2: 105,696,450 E234K probably benign Het
Pramef17 T A 4: 143,994,226 K48N probably benign Het
Prkdc A G 16: 15,791,946 E3138G probably damaging Het
Ptprc T A 1: 138,083,567 N584I probably damaging Het
Ptprt A G 2: 161,547,387 V1261A probably damaging Het
Rps20 A T 4: 3,834,610 I84N probably damaging Het
Scd3 A G 19: 44,241,717 Y313C probably damaging Het
Sertad2 T C 11: 20,648,482 I226T probably benign Het
Slc15a2 A T 16: 36,772,128 C191* probably null Het
Slco1a1 G T 6: 141,943,437 Q50K possibly damaging Het
Stab2 A T 10: 86,949,912 I622N possibly damaging Het
Tmc4 C T 7: 3,672,007 V222M probably benign Het
Tmem145 T C 7: 25,311,361 F359L probably damaging Het
Tmem238 C A 7: 4,789,079 R155L possibly damaging Het
Vmn1r32 C A 6: 66,553,663 C43F probably benign Het
Vmn2r104 C T 17: 20,029,921 R696K probably benign Het
Other mutations in Cyp2d34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Cyp2d34 APN 15 82617535 missense probably damaging 0.96
IGL00914:Cyp2d34 APN 15 82620714 missense probably damaging 0.98
IGL01347:Cyp2d34 APN 15 82616777 missense possibly damaging 0.89
IGL01354:Cyp2d34 APN 15 82617622 missense probably benign 0.00
IGL01681:Cyp2d34 APN 15 82617131 critical splice donor site probably null
IGL01733:Cyp2d34 APN 15 82618660 missense possibly damaging 0.73
IGL02231:Cyp2d34 APN 15 82618606 missense probably benign 0.44
IGL02425:Cyp2d34 APN 15 82618279 missense probably benign
IGL03219:Cyp2d34 APN 15 82618539 missense probably benign 0.01
R0684:Cyp2d34 UTSW 15 82617550 missense probably benign 0.06
R0811:Cyp2d34 UTSW 15 82618606 missense probably benign 0.44
R0812:Cyp2d34 UTSW 15 82618606 missense probably benign 0.44
R1617:Cyp2d34 UTSW 15 82620845 missense probably benign 0.21
R1756:Cyp2d34 UTSW 15 82617524 missense probably damaging 1.00
R1827:Cyp2d34 UTSW 15 82616094 missense probably benign 0.00
R1962:Cyp2d34 UTSW 15 82618608 missense probably benign 0.10
R2102:Cyp2d34 UTSW 15 82616773 missense probably benign 0.17
R2113:Cyp2d34 UTSW 15 82617616 missense probably damaging 1.00
R2432:Cyp2d34 UTSW 15 82619011 missense probably damaging 1.00
R2566:Cyp2d34 UTSW 15 82616167 missense probably damaging 1.00
R3154:Cyp2d34 UTSW 15 82617566 missense probably benign 0.04
R3881:Cyp2d34 UTSW 15 82618617 missense probably benign 0.00
R4022:Cyp2d34 UTSW 15 82618608 missense probably benign 0.10
R4181:Cyp2d34 UTSW 15 82617285 splice site probably null
R4613:Cyp2d34 UTSW 15 82616325 missense probably damaging 0.98
R4636:Cyp2d34 UTSW 15 82620728 missense probably damaging 1.00
R4695:Cyp2d34 UTSW 15 82616891 missense probably benign
R4993:Cyp2d34 UTSW 15 82618329 missense probably damaging 1.00
R5262:Cyp2d34 UTSW 15 82618371 missense probably damaging 1.00
R5402:Cyp2d34 UTSW 15 82619086 missense probably damaging 1.00
R5772:Cyp2d34 UTSW 15 82617140 missense probably null 0.24
R5874:Cyp2d34 UTSW 15 82619042 missense probably benign 0.04
R6051:Cyp2d34 UTSW 15 82616770 missense probably damaging 1.00
R6057:Cyp2d34 UTSW 15 82616351 missense probably benign
R6143:Cyp2d34 UTSW 15 82620776 missense probably benign 0.25
R6452:Cyp2d34 UTSW 15 82616089 missense probably benign 0.00
R7296:Cyp2d34 UTSW 15 82617235 missense possibly damaging 0.87
R7391:Cyp2d34 UTSW 15 82618386 missense probably benign 0.14
R7398:Cyp2d34 UTSW 15 82616763 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGCAACCATCCCTGTGTTC -3'
(R):5'- ACGCTAGGTAGAGTTCAACAG -3'

Sequencing Primer
(F):5'- GTGTTCAATGCTCCATAAAGTGTCC -3'
(R):5'- TTCAACAGGAAATCGATGCAGTC -3'
Posted On2015-04-06