Incidental Mutation 'R3835:Ovgp1'
ID275575
Institutional Source Beutler Lab
Gene Symbol Ovgp1
Ensembl Gene ENSMUSG00000074340
Gene Nameoviductal glycoprotein 1
SynonymsChit5, MOGP, muc9, mucin 9, OGP, oviductin
MMRRC Submission 040890-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3835 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location105973711-105987423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105986315 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 468 (E468G)
Ref Sequence ENSEMBL: ENSMUSP00000000573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000573] [ENSMUST00000163626]
Predicted Effect probably benign
Transcript: ENSMUST00000000573
AA Change: E468G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000000573
Gene: ENSMUSG00000074340
AA Change: E468G

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Glyco_18 22 360 1.38e-134 SMART
low complexity region 486 515 N/A INTRINSIC
low complexity region 533 626 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000092878
Predicted Effect probably benign
Transcript: ENSMUST00000163626
SMART Domains Protein: ENSMUSP00000132424
Gene: ENSMUSG00000074340

DomainStartEndE-ValueType
Glyco_18 9 226 8.52e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167642
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, carbohydrate-rich, epithelial glycoprotein with numerous O-glycosylation sites located within threonine, serine, and proline-rich tandem repeats. The gene is similar to members of the mucin and the glycosyl hydrolase 18 gene families. Regulation of expression may be estrogen-dependent. Gene expression and protein secretion occur during late follicular development through early cleavage-stage embryonic development. The protein is secreted from non-ciliated oviductal epithelial cells and associates with ovulated oocytes, blastomeres, and spermatozoan acrosomal regions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show no phenotypic abnormalities. Female reproduction is essentially normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
2610507B11Rik A G 11: 78,279,085 R1545G probably benign Het
Adgrl4 T C 3: 151,510,617 I479T probably damaging Het
Adh6a G A 3: 138,327,514 probably null Het
Anapc7 A G 5: 122,443,877 T528A possibly damaging Het
Ap5b1 A G 19: 5,568,890 T113A possibly damaging Het
Apaf1 G A 10: 91,059,587 R439C probably benign Het
Apoa5 A T 9: 46,270,580 H318L probably damaging Het
Btnl9 T G 11: 49,180,685 T104P probably damaging Het
Dennd5a T C 7: 109,934,242 K107R probably benign Het
Dthd1 A T 5: 62,849,785 R610W probably damaging Het
Eno1 T C 4: 150,246,662 S186P probably benign Het
Fam208b T C 13: 3,575,292 T1553A probably benign Het
Gipc2 C A 3: 152,128,186 V153F probably damaging Het
Gm884 C A 11: 103,620,010 L377F unknown Het
Gpt A G 15: 76,698,583 Y295C probably damaging Het
Kcnh5 T A 12: 74,898,270 Q735L probably benign Het
Lrrc10 A G 10: 117,045,786 N122D possibly damaging Het
Meis2 T C 2: 115,921,747 H301R probably damaging Het
Muc5b A T 7: 141,859,181 I1955F unknown Het
Nalcn A T 14: 123,293,422 probably benign Het
Nmt2 T C 2: 3,314,686 probably benign Het
Nnt C T 13: 119,372,495 G403R probably damaging Het
Olfr1252 T G 2: 89,721,455 I219L possibly damaging Het
Olfr1428 T A 19: 12,109,400 I49F possibly damaging Het
Olfr1463 A T 19: 13,234,739 D163V probably benign Het
Pax6 G A 2: 105,696,450 E234K probably benign Het
Prkdc A G 16: 15,791,946 E3138G probably damaging Het
Prmt6 T C 3: 110,250,805 D56G possibly damaging Het
Ptprt A G 2: 161,547,387 V1261A probably damaging Het
Qtrt2 A G 16: 43,881,072 S42P probably damaging Het
Rab9b C T X: 136,861,510 R47Q possibly damaging Het
Rpgrip1 A G 14: 52,147,253 E606G probably damaging Het
Setx C T 2: 29,145,060 S519L possibly damaging Het
Slc15a2 A T 16: 36,772,128 C191* probably null Het
Snrk T C 9: 122,137,003 probably benign Het
St6galnac1 T C 11: 116,766,283 D422G probably damaging Het
Stag1 C T 9: 100,737,982 T46I probably damaging Het
Tagln T C 9: 45,931,710 I18V probably benign Het
Tbx18 C A 9: 87,729,636 A114S probably benign Het
Ttc16 T C 2: 32,769,310 D259G probably damaging Het
Vldlr A G 19: 27,234,814 D76G probably damaging Het
Vmn2r24 G T 6: 123,787,453 D430Y probably benign Het
Xlr3a T C X: 73,095,038 E5G probably damaging Het
Other mutations in Ovgp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Ovgp1 APN 3 105981277 nonsense probably null
IGL01152:Ovgp1 APN 3 105986172 missense possibly damaging 0.94
IGL01458:Ovgp1 APN 3 105974991 missense probably benign 0.01
IGL01646:Ovgp1 APN 3 105978349 missense probably damaging 1.00
IGL01768:Ovgp1 APN 3 105981351 critical splice donor site probably null
IGL02712:Ovgp1 APN 3 105986513 unclassified probably benign
IGL03065:Ovgp1 APN 3 105986366 missense probably benign 0.01
IGL03140:Ovgp1 APN 3 105979906 missense probably damaging 1.00
IGL03272:Ovgp1 APN 3 105981325 missense probably damaging 0.99
PIT4472001:Ovgp1 UTSW 3 105986990 missense unknown
R0277:Ovgp1 UTSW 3 105979892 intron probably benign
R0560:Ovgp1 UTSW 3 105986410 unclassified probably benign
R0718:Ovgp1 UTSW 3 105974830 splice site probably benign
R0743:Ovgp1 UTSW 3 105974932 missense probably damaging 1.00
R1362:Ovgp1 UTSW 3 105986575 unclassified probably benign
R1556:Ovgp1 UTSW 3 105986752 unclassified probably benign
R1776:Ovgp1 UTSW 3 105977798 missense possibly damaging 0.52
R1831:Ovgp1 UTSW 3 105985068 missense probably benign 0.04
R1986:Ovgp1 UTSW 3 105974935 missense probably damaging 1.00
R2004:Ovgp1 UTSW 3 105986993 unclassified probably benign
R2156:Ovgp1 UTSW 3 105977717 missense possibly damaging 0.49
R2254:Ovgp1 UTSW 3 105986912 unclassified probably benign
R2860:Ovgp1 UTSW 3 105986567 unclassified probably benign
R2861:Ovgp1 UTSW 3 105986567 unclassified probably benign
R3117:Ovgp1 UTSW 3 105986452 unclassified probably benign
R3793:Ovgp1 UTSW 3 105980171 missense probably benign 0.03
R3894:Ovgp1 UTSW 3 105986567 unclassified probably benign
R3894:Ovgp1 UTSW 3 105986596 unclassified probably benign
R3895:Ovgp1 UTSW 3 105986596 unclassified probably benign
R4050:Ovgp1 UTSW 3 105986596 unclassified probably benign
R4050:Ovgp1 UTSW 3 105986567 unclassified probably benign
R4467:Ovgp1 UTSW 3 105977711 missense probably benign 0.04
R4611:Ovgp1 UTSW 3 105986567 unclassified probably benign
R4628:Ovgp1 UTSW 3 105980323 intron probably null
R4738:Ovgp1 UTSW 3 105979918 missense probably damaging 1.00
R4944:Ovgp1 UTSW 3 105979953 missense possibly damaging 0.66
R5110:Ovgp1 UTSW 3 105977783 missense probably damaging 1.00
R6531:Ovgp1 UTSW 3 105987071 unclassified probably benign
R6540:Ovgp1 UTSW 3 105986581 nonsense probably null
R6562:Ovgp1 UTSW 3 105980273 missense probably damaging 1.00
R6601:Ovgp1 UTSW 3 105986431 unclassified probably benign
R6906:Ovgp1 UTSW 3 105986873 unclassified probably benign
R7313:Ovgp1 UTSW 3 105987071 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGGACCTGGCTCTGAGAATAC -3'
(R):5'- GTCTTAGAAACCCCAGCAGTGG -3'

Sequencing Primer
(F):5'- TGGCTCTGAGAATACAGCCTTGAC -3'
(R):5'- CCTTAGAAATCTCAGGGATGGTC -3'
Posted On2015-04-06