Incidental Mutation 'R3836:Ecel1'
ID275615
Institutional Source Beutler Lab
Gene Symbol Ecel1
Ensembl Gene ENSMUSG00000026247
Gene Nameendothelin converting enzyme-like 1
SynonymsXCE, DINE
MMRRC Submission 040891-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3836 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87147655-87156521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 87150656 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 565 (L565R)
Ref Sequence ENSEMBL: ENSMUSP00000125096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027463] [ENSMUST00000160810] [ENSMUST00000161002]
Predicted Effect probably damaging
Transcript: ENSMUST00000027463
AA Change: L565R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027463
Gene: ENSMUSG00000026247
AA Change: L565R

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 6.4e-112 PFAM
Pfam:Peptidase_M13 571 774 5.2e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159662
Predicted Effect probably damaging
Transcript: ENSMUST00000160810
AA Change: L565R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125557
Gene: ENSMUSG00000026247
AA Change: L565R

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 1.2e-98 PFAM
Pfam:Peptidase_M13 571 774 2.3e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161002
AA Change: L565R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125096
Gene: ENSMUSG00000026247
AA Change: L565R

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 6.4e-112 PFAM
Pfam:Peptidase_M13 571 774 5.2e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187198
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M13 family of endopeptidases. Members of this family are zinc-containing type II integral-membrane proteins that are important regulators of neuropeptide and peptide hormone activity. Mutations in this gene are associated with autosomal recessive distal arthrogryposis, type 5D. This gene has multiple pseudogenes on chromosome 2. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Targeted mutations of this gene result in respiratory distress causing neonatal lethality due to reduced diaphram innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Aasdh A G 5: 76,878,468 V903A probably benign Het
Ankrd6 T A 4: 32,817,531 D271V probably damaging Het
Ano10 C T 9: 122,263,763 V167M possibly damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
AW551984 T C 9: 39,597,908 probably benign Het
Bub1 G T 2: 127,814,886 P442Q probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crym A G 7: 120,201,216 V61A probably benign Het
Dock4 G T 12: 40,794,624 probably null Het
Dtna A T 18: 23,625,102 Q488L probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fnbp4 A G 2: 90,746,785 T154A probably damaging Het
Fsip2 T C 2: 82,950,946 L32P probably damaging Het
Gldc T A 19: 30,118,675 probably benign Het
Gm12695 T G 4: 96,762,097 T171P probably damaging Het
Gm4868 A C 5: 125,847,950 noncoding transcript Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gstm5 T C 3: 107,896,362 I37T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga11 G T 9: 62,769,283 V918L probably benign Het
Itgb2l T A 16: 96,426,167 M559L probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Madd A T 2: 91,154,643 probably null Het
Map3k11 A G 19: 5,690,803 E186G possibly damaging Het
Mbl2 T C 19: 30,239,514 F242S probably damaging Het
Mcph1 A G 8: 18,622,659 T102A possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mkln1 A G 6: 31,468,336 D389G probably damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Myd88 A G 9: 119,338,193 probably benign Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nprl3 C T 11: 32,233,082 E502K probably damaging Het
Nudt5 T A 2: 5,866,347 probably null Het
Olfr1045 A G 2: 86,198,662 V30A probably benign Het
Olfr191 A G 16: 59,086,223 S87P possibly damaging Het
Olfr691 G A 7: 105,337,210 P169S probably benign Het
Olfr810 C T 10: 129,791,170 V140M probably benign Het
Plaa T C 4: 94,586,922 probably null Het
Ptk2b A G 14: 66,156,342 L894P probably damaging Het
Rab8b A G 9: 66,847,796 S183P probably benign Het
Reln A G 5: 21,911,014 Y2999H probably damaging Het
Rims4 A G 2: 163,918,653 S11P possibly damaging Het
Scel A G 14: 103,592,386 K448R possibly damaging Het
Serpinb10 A T 1: 107,536,086 T33S probably benign Het
Sgip1 A G 4: 102,867,700 probably null Het
Spata5 T A 3: 37,433,643 Y428N possibly damaging Het
Sv2b A T 7: 75,157,428 M158K probably damaging Het
Tmem132d A T 5: 127,784,885 I724N probably damaging Het
Tnrc6c A G 11: 117,723,229 T738A probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Ubtfl1 A T 9: 18,409,237 E20D possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r25 C A 6: 123,853,085 D36Y probably damaging Het
Wdhd1 A G 14: 47,245,054 V946A probably benign Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Zmynd8 G A 2: 165,858,099 T14I probably benign Het
Other mutations in Ecel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Ecel1 APN 1 87153193 missense possibly damaging 0.84
IGL01431:Ecel1 APN 1 87151504 missense probably damaging 0.99
IGL01992:Ecel1 APN 1 87149855 splice site probably benign
IGL02040:Ecel1 APN 1 87154923 missense probably benign 0.32
IGL02230:Ecel1 APN 1 87152194 missense probably damaging 1.00
IGL02801:Ecel1 APN 1 87152003 missense probably damaging 1.00
Capulin UTSW 1 87153301 missense probably damaging 0.99
R0139:Ecel1 UTSW 1 87154526 missense possibly damaging 0.95
R1723:Ecel1 UTSW 1 87154421 missense probably benign 0.37
R2118:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2119:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2120:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2122:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R3815:Ecel1 UTSW 1 87152900 missense probably damaging 0.97
R4211:Ecel1 UTSW 1 87152150 missense probably damaging 1.00
R4685:Ecel1 UTSW 1 87152946 splice site probably null
R4841:Ecel1 UTSW 1 87153301 missense probably damaging 0.99
R4842:Ecel1 UTSW 1 87153301 missense probably damaging 0.99
R4888:Ecel1 UTSW 1 87148727 splice site probably benign
R4976:Ecel1 UTSW 1 87151139 missense probably benign 0.17
R5032:Ecel1 UTSW 1 87154253 missense probably damaging 0.97
R5119:Ecel1 UTSW 1 87151139 missense probably benign 0.17
R5393:Ecel1 UTSW 1 87152876 missense possibly damaging 0.95
R5798:Ecel1 UTSW 1 87151483 missense probably damaging 1.00
R5862:Ecel1 UTSW 1 87149596 missense probably benign 0.19
R5874:Ecel1 UTSW 1 87148009 missense probably benign 0.24
R6341:Ecel1 UTSW 1 87150471 splice site probably null
R6351:Ecel1 UTSW 1 87149509 missense possibly damaging 0.56
R6534:Ecel1 UTSW 1 87154842 missense probably benign 0.13
R7405:Ecel1 UTSW 1 87153516 critical splice donor site probably null
R7422:Ecel1 UTSW 1 87149612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGGGTCATACAGGGTG -3'
(R):5'- GACAAATCCTCGTGAGTGCC -3'

Sequencing Primer
(F):5'- TCATACAGGGTGGGCTGCAG -3'
(R):5'- ATGCTGGGAACACAGGCCTG -3'
Posted On2015-04-06